Information

Anbringen von Suspensionszellen an das Deckglas während des Nachweises einer Mykoplasmenkontamination

Anbringen von Suspensionszellen an das Deckglas während des Nachweises einer Mykoplasmenkontamination


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ich plane, meine Zellkulturen mit der Hoechst 33258 DNA-Färbemethode auf Mykoplasmenkontamination zu screenen.

Diese Methode ist für adhärente Kulturen geeignet. Ist diese Methode für Suspensionskulturen geeignet?

Wenn ja, wie kann ich meine Suspensionskultur auf dem Deckglas anbringen und das Auswaschen der Zellen während der Färbung verhindern?


Wenn Sie mit Suspensionszellen arbeiten, ist es immer einfacher, Durchflusszytometrie zu verwenden, aber wenn Sie Mikroskopie verwenden möchten, würde ich die Verwendung von Kammerobjektträgern vorschlagen. Sie müssen nur Ihre Zellsuspension in die Kammer geben und die Zellen dann auf den Objektträger kleben. Danach können Sie jede gewünschte Behandlung durchführen, indem Sie einfach die richtige Lösung in die Kammer geben und danach waschen. Je mehr Schritte, desto mehr Zellen verlieren Sie hauptsächlich durch das Pipettieren. Versuchen Sie also, immer an der gleichen Ecke zu pipettieren und seien Sie vorsichtig. Um die Zellen auf den Objektträger zu kleben, ist es am besten, den Objektträger zu zentrifugieren. Leider war das in meinem Labor keine Option, also habe ich die Zellen einfach mit Methanol fixiert, während sie in PBS suspendiert waren und es funktionierte sehr gut. Die meisten Zellen waren auf dem Objektträger befestigt und die Färbung war perfekt. Hoffe ich habe geholfen. Viel Glück!


In-situ-Nachweis von Mykoplasmen-Kontaminationen in Zellkulturen durch fluoreszierende Hoechst 33258-Färbung ☆

Es wird über eine einfache, schnelle und leicht reproduzierbare Routinelabortechnik zum Nachweis einer Mykoplasmenkontamination in Zellkulturen berichtet. Auf einem Deckglas gezüchtete Zellen werden direkt mit Carnoy's fixiert, luftgetrocknet, mit DNA-spezifischem Fluoreszenzlicht Hoechst 33258 gefärbt und mikroskopisch untersucht. Alle mit Mykoplasmen infizierten Kulturen wiesen im Gegensatz zu den nicht kontaminierten Kontrollkulturen, bei denen der extranukleäre Hintergrund einheitlich dunkel erschien, leicht erkennbare, kleine, morphologisch einheitliche, hell fluoreszierende Körper im extranuklearen und interzellulären Raum auf. Um den Grad der Sensitivität für den Nachweis von Mykoplasmen zu prüfen, wurden Kontrollkulturen mit Aliquots von seriell verdünnten Zellen oder Medien infiziert, die von Mycoplasma hyorhinus infizierte Kulturen. Die derzeit niedrigste Infektionsrate (0,40 % bei Probennahme von durchschnittlich 1 000 Zellen pro Kultur 4–24 h nach Infektion) kann jedoch durch Erhöhung der Probengröße leicht gesenkt werden, da eine mit nur einem Mykoplasma infizierte Zelle erkannt werden kann. Diese Mykoplasmen widersetzten sich einer 30-minütigen Zentrifugation bei 2.500 U/min und wurden leicht durch eine Filtermembran mit einer Porengröße von 0,22 &mgr;m gefiltert. Erstaunlicherweise erreichte eine Infektionsrate von 0,63 %, die 24 h nach der Infektionsinkubation erzielt wurde, eine 100 %ige Kontamination mit mehreren Hundert Mykoplasmen pro Wirtszelle innerhalb von 120 h.

Diese Arbeit wurde durch USPHS Grant GM 19513 unterstützt.


20 - Ein Leitfaden für grundlegende Zellkulturen und Anwendungen in Biomaterialien und Tissue Engineering

In diesem Kapitel wird dargestellt, dass viele der Fortschritte im Verständnis der Zellbiologie aus der Zellisolierung hervorgegangen sind und in vitro Studien. Beim Vergleich ist jedoch Vorsicht geboten in vitro Modelle zum multifaktoriellen und multizellulären in vivo Umgebung. Zellen verhalten sich ausnahmslos anders in vivo aufgrund des Vorhandenseins anderer Zelltypen, zahlreicher Zellsignalfaktoren und der extrazellulären Matrix sowie physiologischer Unterschiede in Bezug auf mechanischen Stress, Blutfluss und 3-D-Wachstum. Der Zelltyp muss auch sorgfältig ausgewählt werden für in vitro Experimente in Bezug auf die in vivo Umgebung. Aufgrund der einfachen Isolierung wurde beispielsweise die überwiegende Mehrheit der Zellkulturstudien an Endothelzellen an Endothelzellen durchgeführt, die aus Makrogefäßen (großen Gefäßen) in menschlicher Vorhaut isoliert wurden. Es wurde jedoch nun gezeigt, dass sich die phänotypische Expression und das Verhalten von Endothelzellen sowohl zwischen der Art des Gefäßes (Blut, Vene oder Lymphgefäß), der Gefäßgröße (Kapillare, Arteriole oder Arterie) als auch der Lage der Gefäße (Haut, Gehirn usw.). Ob diese Unterschiede im Verhalten von Endothelzellen durch Faktoren induziert werden, die in der lokalen Umgebung erzeugt werden, und/oder auf unterschiedliche Endothelzelllinien zurückzuführen sind, ist ungewiss, aber die Auswahl des Endothelzelltyps hat eindeutig wichtige Konsequenzen für den Erfolg von Gewebe- und Biomaterialien, die durch Tissue-Engineering hergestellt werden Forschung.


Materialen und Methoden

Probenvorbereitung und Biosicherheit

Überstände der Zellkultur wurden hergestellt, indem zellfreie Überstände geerntet und weitere Zelltrümmer durch Zentrifugation in konischen 15 ml-Röhrchen bei 200 g bei Raumtemperatur für 5 Minuten entfernt wurden. Sie wurden bis zur Verwendung bei –80°C gefroren aufbewahrt. Alle Proben wurden unter einem Typ II Laminar-Flow- und Biosicherheits-Level-Labor-Containment (BSL2, 3 oder 4) manipuliert, wie es für die Manipulation von Zellen und Viren bis zu ihrer vollständigen Inaktivierung erforderlich ist. Zu den Proben gehören routinemäßige Überprüfungen auf Mykoplasmenkontamination in Zelllinien und Virusbeständen (oder infizierten Zellen) von RNA-Viren (Masern, Staupe, vesikuläre Stomatitis, Ebola, Nipah, Influenza, hämorrhagisches Krim-Kongo-Fieber, humanes T-Lymphotropie I, Drosophila C, Drosophila X, Mopeia, Puumala, Zigeunervirus) und DNA-Viren (Epstein Barr, BK-Virus).

DNA-Färbung mit Hoechst-Reagenz

Das Prinzip besteht darin, Mykoplasmenkolonien, die neben Zellen wachsen, zu erkennen, indem man DNA-Punkte sichtbar macht, die sich außerhalb der Zellkerne befinden. Der indirekte Assay wurde wie zuvor beschrieben verwendet [3]. Kurz gesagt wurde eine Suspension von Indikatorzellen durch Ablösen von der Gewebekulturflasche durch eine kurze Trypsin-EDTA-Behandlung, Zählen und Resuspendieren in frischem Gewebekulturmedium hergestellt. Um geeignete Zelllinien einzubeziehen, die der zytopathischen Wirkung mehrerer menschlicher Viren widerstehen können, mit denen unsere Mitarbeiter arbeiteten, wurde der Assay mit fünf Zelllinien unterschiedlichen Ursprungs validiert (siehe Tabelle 1 für Details). Quadratische (22 x 22 mm) sterile Deckgläser wurden auf den Boden einer Mikrotiterplatte mit 6 Vertiefungen aufgebracht. Zwei ml Indikatorzellsuspension pro Vertiefung wurden über Nacht anhaften gelassen, bevor 0,2 ml der zu testenden zellfreien Probe zugegeben wurden. Die Zellen wurden über 5–7 Tage in 5 % CO . wachsen gelassen2 in befeuchteter Atmosphäre bei 37 °C. Wenn Zellen erreichen

50–80% Konfluenz, der Überstand wurde vorsichtig verworfen, der Zellmonolayer wurde einmal sorgfältig mit PBS1X pH 7.2 gewaschen und für 10 min bei RT durch Zugabe von 2 mL Ethanol/Essigsäure (3:1, vol:vol) fixiert. Das Fixiermittel wurde verworfen und 2 ml von 2 µg/ml Hoechst (bis Benzimide, Sigma Kat.-Nr. B-2883)-Lösung, verdünnt in PBS1X, aus einer 500X-Stammlösung, die bei -20 °C aliquotiert gehalten wurde, wurden zugegeben und 10&supmin; inkubiert min bei Zimmertemperatur. Die Färbelösung wurde verworfen und es folgten zwei sorgfältige Waschungen mit klarem Wasser. Nach Zugabe von 15 &mgr;l FluoPrep (BioMérieux, Kat.-Nr. 75521) wurde das Deckglas auf einen Glasobjektträger übertragen, um die Zellmonoschicht mit dem Objektträger in Kontakt zu bringen. Der Objektträger wurde durch UV-Epifluoreszenz-Mikroskopie (360 nm Anregungsfilter und Sperrfilter, der eine Emission von 490–500 nm ermöglichte, 100X Ölobjektiv) untersucht. Mehrere Felder wurden für das Fehlen oder Vorhandensein von fluoreszierenden Punkten aufgezeichnet. Biogefährdung: Paraformaldehyd und Hoechst-Lösungen und UV-Mikroskop sind gefährlich. Da die Anpassung dieses Verfahrens durch die Verwendung von Ibidi-Polymerdeckgläsern (Biovalley, Kat.-Nr. 80826, Nr. 80446) anstelle von Glasdeckgläsern nicht erfolgreich war, konnte der Hoechst-Färbeassay gemäß den lokalen Biosicherheitsvorschriften weder in BSL3- noch in BSL4-Containment verwendet werden .


Halbautomatische relative Quantifizierung der Zellkulturkontamination mit Mykoplasmen durch Photoshop-basierte Bildanalyse an Immunfluoreszenzpräparaten

Die Kontamination mit Mykoplasmen in der Zellkultur ist ein schwerer Rückschlag für den Zellzüchter. Es ist bekannt, dass Experimente mit kontaminierten Zellkulturen aufgrund verschiedener morphologischer, biochemischer und genetischer Effekte zu unzuverlässigen oder falschen Ergebnissen führen. Frühere Untersuchungen ergaben, dass die Inzidenz von Mykoplasmen-Kontaminationen in Zellkulturen zwischen 15 und 80 % liegt. Aus einer Vielzahl von Methoden zum Nachweis von Mykoplasmen in Zellkulturen zeigen die zytologischen Methoden direkt den kontaminierenden Organismus, der in Verbindung mit den kultivierten Zellen vorhanden ist. In dieser Untersuchung berichten wir über die Einführung eines zytologischen Immunfluoreszenz-Assays (IFA), um eine halbautomatische relative Quantifizierung der Kontamination durch den Einsatz der benutzerfreundlichen Photoshop-basierten Bildanalyse zu erhalten. Die Studie, die an 77 zufällig aus verschiedenen Laboratorien gesammelten Zellkulturen durchgeführt wurde, ergab eine Mykoplasmenkontamination in 18 Zellkulturen gleichzeitig durch IFA- und Hoechst-DNA-Fluorochrom-Färbungsverfahren. Es wurde beobachtet, dass die Photoshop-basierte Bildanalyse von IFA-gefärbten Objektträgern als sensibles Werkzeug zur quantitativen Bewertung des Kontaminationsausmaßes sehr wertvoll war an sich und im Vergleich zur Zellularität von Zellkulturen. Die Technik könnte nützlich sein, um die Wirksamkeit von Antimykoplasmen-Mitteln während Dekontaminierungsmaßnahmen abzuschätzen.


Diskussion

In letzter Zeit haben postnatale Stammzellen aus Zahngeweben im Bereich des Tissue Engineering und der regenerativen Medizin große Aufmerksamkeit hinsichtlich relativ einfacher Zugänglichkeit, Multidifferenzierungskapazität und möglicher autologer Implantation erhalten. Implantationsstudien zeigten in vivo Regenerationsfähigkeit von Knochen- und Nervengewebe von implantierten Stammzellen aus Zahngewebe [13,14,20]. In Bezug auf den entwicklungsbedingten Ursprung, das sogenannte Neuralleisten-abgeleitete Ektomesenchym, von Stammzellen, die an der Zahnmorphogenese beteiligt sind, können unter bestimmten Umständen verschiedene Abstammungsliniendifferenzierung, mesenchymale Differenzierung und neuroektodermale Differenzierung von postnatalen Stammzellen aus Zahngewebe abgeleitet werden [1,2]. Die Verweildauer von postnatalen Stammzellen, die eine Multidifferenzierungskapazität aufweisen, wurde in verschiedenen Zahngeweben wie Zahnpulpa, Parodontalligament und Papillegewebe identifiziert [3,6,7] und unter diesen Zahngeweben Papillengewebe, das im Allgemeinen in ein sich entwickelnder Zahn ist bekanntlich ein Pool von Stammzellen [21]. In unserer Studie konnten durch die Kultur unter verschiedenen Kulturbedingungen während der Expansion von Stammzellen aus apikaler Papille (hSCAPs) verschiedene Stammzellpopulationen erzeugt werden, und eine Stammzellpopulation mit fibroblastischer Spindelform während der Expansion exprimierte mesenchymale Marker wie Stro-1 und CD44, die mit dem vorherigen Bericht übereinstimmen, um die Ableitung von Stammzellen mit mesenchymalen Eigenschaften aus Zahnpapillengewebe zu zeigen [3], aber während der hSCAPs-Expansion in Gegenwart von EGF, FGF2 und LIF erschien eine unterschiedliche Zellpopulation mit kugelförmiger Form und wurde exprimiert von neuralen Stammzellmarkern wie Nestin und CD133 [22]. Sowohl die Expression des mesenchymalen als auch des neuralen Stammzellherstellers von Papille-abgeleiteten Stammzellen könnte mit ihren Stammzelleigenschaften zusammenhängen, die vom Neuralleisten-abgeleiteten Ektomesenchym im Zahnentwicklungsprozess abgeleitet werden [9,23]. Es könnte jedoch notwendig sein, mehr über die Eigenschaften von postnatalen Stammzellen aus Zahngewebe zu untersuchen, um ihre therapeutischen Anwendungen zu erweitern.

Trotz der starken Nützlichkeit von Stammzellen aus Zahngewebe in Tissue Engineering und regenerativer Medizin, für klinische Anwendungen und Stammzellforschung mit postnatalen Stammzellen aus Zahngewebe sollte eine bakterielle Kontamination in Betracht gezogen werden, da die meisten Zähne normalerweise aufgrund von oralen Erkrankungen wie z B. in der Mundhöhle, die häufig mit bakteriellen Infektionen in Zusammenhang stehen könnten. Mykoplasmen sind insbesondere einer der beliebtesten Mikroorganismen, die häufig in der Mundhöhle vorkommen [16], und ist der kleinste Prokaryot mit einem Durchmesser von weniger als 1 µm, dessen geringe Größe es Mykoplasmen ermöglicht, durch konventionelle Filter zu gelangen, die verwendet werden, um eine bakterielle und Pilzkontamination zu verhindern, und Mykoplasmen leicht in Wirtstierzellen absorbieren [15]. Da Zahngewebe häufig einer bakteriellen Infektion ausgesetzt sein kann, ist eine Mykoplasmeninfektion von vermehrten Zellkulturen aus Zahngewebe wahrscheinlich unvermeidbar. In unserer Studie wurden dem Patienten die meisten Prämolaren und dritten Backenzähne für orthopädische Operationen zur Heilung von Munderkrankungen entnommen und Papillengewebe wurde aus den verworfenen Zähnen gewonnen. Nach der Isolierung wurde die Mykoplasmenkontamination mit primär kultivierten hSCAPs bewertet, und die meisten hSCAPs wurden durch Mykoplasmen kontaminiert, was durch positive Färbung und mykoplasmenspezifische DNA-Expression nachgewiesen wurde. Um die mögliche Kreuzkontamination durch andere Zellen in unserem Labor zu bestätigen, wurden Fettstammzellen, humane dermale Fibroblasten und primär kultivierte Parodontalligamentzellen verwendet, um eine Mykoplasmenkontamination zu testen, aber es gab keine Anzeichen einer Mykoplasmenkontamination (Daten nicht gezeigt). Es ist bekannt, dass eine solche Mykoplasmenkontamination viele Aspekte der Zellphysiologie wie Zellproliferation, Chromosomenaberration und auch immunologische Reaktionen beeinflusst [17,18]. Zum Beispiel wurde die 50%ige Hemmung der Zellproliferation durch die Beeinflussung der Nährstoffaufnahme der Zellen während der Zellkultur berichtet [17]. Darüber hinaus auf in vivo Implantation von Mykoplasmen-kontaminierten Zellen könnten Mykoplasmen aus infizierten Zellen Wirtszellen beeinflussen, die an immunologischen Reaktionen wie Makrophagenaktivierung und Hemmung der Antigenpräsentation teilnehmen [18]. In unserer Studie wurden die kontaminierten Mykoplasmen in hSCAPs eliminiert und es wurde festgestellt, dass die Mykoplasmenkontamination die Zellproliferationsaktivität von Primärkultur-hSCAPs beeinflusste. Schließlich zeigten die mykoplasmeneliminierten hSCAPs unter bestimmten Kulturbedingungen eine Multidifferenzierungskapazität in osteogene und neurale Zelllinien, und auch eine osteogene und neurale 3D-Differenzierung konnte erfolgreich unter Verwendung von Hydrogel-Einkapselungstechniken oder dynamischen Kultursystemen für ihre Anwendung im Tissue Engineering induziert werden. Unsere Studie könnte darauf hindeuten, dass der experimentelle Prozess der Mykoplasmenelimination für die Primärzellkultur und für die Anwendung von Primärzellen für das Tissue Engineering und die regenerative Medizin erforderlich sein kann, aber sein zeitaufwändiger und teurer Prozess, der ungefähr 7–10 Tage dauert, ist immer noch ein zu überwindendes Problem für seine praktische Anwendung auf konventionelle Kulturverfahren.


TrypLE-Dissoziationsenzyme

Gibco TrypLE Express und TrypLE Select sind mikrobiell hergestellte Zelldissoziationsenzyme mit ähnlichen Kinetiken und Spaltungsspezifitäten wie Trypsin. Obwohl Gibco™ TrypLE™ Enzyme Trypsin in Dissoziationsverfahren direkt ersetzen können, ohne dass Protokolländerungen erforderlich sind, empfehlen wir Ihnen, zunächst die Inkubationszeit für die Dissoziation zu optimieren. Da TrypLE-Enzyme rekombinante pilzliche Trypsin-ähnliche Proteasen sind, sind sie ideal für Anwendungen, die Reagenzien tierischen Ursprungs erfordern. Die folgende Tabelle vergleicht TrypLE Express und TrypLE Select mit Trypsin.


STRATEGISCHE PLANUNG

Dieses Protokoll wurde basierend auf hiPSC-Linien entwickelt, die aus menschlichen dermalen Fibroblasten abgeleitet wurden, die gemäß den Anweisungen des Herstellers mit dem Cytotune TM Sendai-Virus umprogrammiert wurden. Wir empfehlen das Einfrieren von Backup-Cryovials von Fibroblasten und transduzierten Fibroblasten sowie Backup-Vials von 6-10 Klonen pro Probanden um Passage (p) 5-10 (Abb. 1). Hier beginnen wir mit diesen uncharakterisierten p5-p10-hiPSC-Klonen und enden mit dem Einfrieren von MCBs und WCBs um p18-p25 bzw. p23-p30 (+ p5) ( 1 ). Qualitätskontrollen werden in den Supportprotokollen 1-4 beschrieben. Das Protokoll kann an jedes andere Reprogrammierungsverfahren angepasst werden, beispielsweise an die episomale Transduktion von Reprogrammierungsfaktoren, indem die Qualitätskontrollen wie die Transgen-Clearance-Kontrollen entsprechend geändert werden. Auch andere primäre Zelltypen, wie Lymphozyten oder Urinzellen, und andere Kulturverfahren können in einem ähnlichen Arbeitsablauf verwendet werden.

Dieses Protokoll beschreibt das Auftauen und die Expansion eines Kryovials eines uncharakterisierten hiPSC-Klons im Bereich von p5-p10, um hiPSCs für einen MCB abzuleiten. Einzelheiten zur allgemeinen hiPSC-Kultur finden Sie bei Frank, Zhang, Schöler & Greber (2012).

Materialien

  • Sechs-Well-Platten oder T75-Kolben, beschichtet mit Geltrex (siehe Rezept)
  • FTDA-Medium mit und ohne Y-27632 (siehe Rezept)
  • Waschmedium (siehe Rezept)
  • Reprogrammierte, uncharakterisierte hiPSC-Klone, p5-p10
  • Y-27632 (Rho-Kinase-Inhibitor)-Lösung (siehe Rezept)
  • Phosphatgepufferte Kochsalzlösung von Dulbecco (PBS, z. B. ThermoFisher 14190)
  • Accutase-Lösung mit Y-27632 (siehe Rezept)
  • Trypanblauer Farbstoff, optional
  • Wasserbad, 37°C
  • Inkubator mit CO2 und N2 Gasversorgung mit einem O2 Regelsystem eingestellt auf 37 °C, 90 % relative Luftfeuchtigkeit (rH), 5 % CO2, 5% O2 (hypoxischer Zustand)
  • Wärmeschrank oder anderes Trockenwärmegerät, 37°C
  • Gefrierschränke, −80 °C und −150 °C (oder flüssiger Stickstoff)
  • Trockeneis
  • Serologische Kunststoffpipetten (z. B. Sarstedt 86.1685.001, 86.1254.001 und 86.1253.001)
  • Konische 50- und 15-ml-Zentrifugenröhrchen (z. B. Falcon ® )
  • Zentrifuge
  • Nunclon ® Delta Surface Sechs-Well-Platten und T75-Kolben (ThermoFisher)
  • Zellzähler (z.B. CASY Zellzähler) oder Neubauer Kammer

Auftauen von hiPSCs

1. Wasserbad und Inkubator (mit Geltrex-beschichteter Platte im Inneren) vorwärmen. Waschmedium und FTDA (beide mit Y-27632) im Wärmeschrank vorwärmen.

1 Million gefrorene hiPSCs können auf 9,6 cm² in 2 ml FTDA (ein Well einer Sechs-Well-Platte) aufgetaut werden, ggf. Plattierung anpassen.

2. Nehmen Sie gefrorene hiPSC-Kryovials, die in einem Flüssigstickstofftank oder einem −150 °C-Gefrierschrank aufbewahrt wurden, auf und überführen Sie sie auf Trockeneis auf die Werkbank. Kryoröhrchen im Wasserbad bei 37 °C für 2-3 Minuten ohne Schütteln auftauen.

Das Wasserbad ist anfällig für Kontaminationen, daher sollten die Fläschchen nach der Entnahme aus dem Wasserbad mit 70%igem Ethanol oder Isopropanol besprüht werden.

3. 5 ml Waschmedium mit einer Pipette aufziehen. Legen Sie die Pipettenspitze in die Kryoröhrchen und ziehen Sie die Zellsuspension nach und nach in das Waschmedium in der Pipette auf. Zellen und Waschmedium langsam an der Innenseite eines konischen 50-ml-Zentrifugenröhrchens ablaufen lassen. 2 min bei 200 × . zentrifugieren g, Zimmertemperatur.

Dies führt zu einer allmählichen Verdünnung der Zellen und des Kryoprotektivums im Medium, was den osmotischen Schock für die hiPSCs verringert.

4. Überstand absaugen, Zellpellet durch Antippen des Röhrchenbodens mit dem Finger lösen und vorsichtig in FTDA-Medium mit Y-27632 resuspendieren. Aspirieren Sie Geltrex-Lösung von den beschichteten Platten und Plattenzellen.

Wenn hiPSC-Klone unter verschiedenen Bedingungen umprogrammiert und eingefroren wurden, tauen Sie sie im Originalmedium auf und ändern Sie die Bedingungen nach dem Auftauen allmählich: z. B. Änderungsverhältnis jeden zweiten Tag von 100 % auf 75 %, 50 % und dann 25 %.

5. Legen Sie die Zellen in einen Inkubator unter hypoxischen Bedingungen bei 37 °C, 90 % rF, 5 % CO2 und 5% O2.

Verteilen Sie die Zellen gleichmäßig, indem Sie die Platte dreimal hin und her, dreimal von einer Seite zur anderen bewegen, und lassen Sie die Zellen mindestens 30 Minuten lang anhaften, bevor Sie die Platte erneut bewegen.

Fütterung von hiPSCs

6. Überwachen Sie hiPSCs täglich unter dem Mikroskop.

Überprüfen Sie die Anheftung der Zellen an die Vertiefung oder den Kolben, die Konfluenz der Zellschicht, die Zellmorphologie, den möglichen Beginn der spontanen Differenzierung (Abb. 2) und die Farbänderung des Mediums.

7. Bereiten Sie Aliquots von FTDA-Medium ohne Y-27632 vor und erwärmen Sie es auf 37 °C.

8. Den größten Teil des Mediums mit einer Pipette für jede Zelllinie aufsaugen. 2-4 ml FTDA tropfenweise in jede Sechs-Well-Platte geben.

Passen Sie die FTDA-Menge an den Medienverbrauch an, der durch die Farbe (pH) des Mediums angezeigt wird. 90%-100% konfluente Zellen (Fig. 2A) profitieren von zweimal täglicher Fütterung und sollten am nächsten Tag passagiert werden.

9. Bringen Sie die Zellen in den Inkubator zurück.

Passage

10. Mit Geltrex beschichtete Platte, PBS, Accutase mit Y-27632 und FTDA mit Y-27632 auf 37 °C vorwärmen.

11. Medium absaugen und mit 1 ml PBS pro 9,6 cm² (d. h. pro Sechs-Well-Platte) waschen.

12. Zellen mit 1 ml Accutase mit Y-27632 pro 9,6 cm² für 5-10 min im Inkubator ablösen.

Überprüfen Sie die Zellen häufig unter dem Mikroskop auf vollständige Ablösung.

13. Zellen in 2 ml Waschmedium pro 9,6 cm² abwaschen und in ein konisches 50-ml-Zentrifugationsröhrchen überführen.

Alle Zellen aus verschiedenen Wells sollten gepoolt und in die nächste Passage verteilt werden.

14. Zentrifugieren Sie 2 min bei 200 × g, Zimmertemperatur. Überstand absaugen, Zellen durch Klopfen auf den Boden des konischen Zentrifugationsröhrchens mit dem Finger lösen und vorsichtig in 500 µl auf 1 ml FTDA mit Y-27632 resuspendieren.

15. Zählen Sie die Zellen mit CASY oder manuell mit Neubauer-Kammer mit Trypanblau-Farbstoff, verdünnt 1:1 mit Zellsuspension.

Proliferation (Verhältnis von geernteten und ausgesäten Zellen) und Lebensfähigkeit (Prozent der lebenden Zellen) sollten bei jeder Passage dokumentiert werden. Das Lebensfähigkeitsziel für die Expansionsphase ist eine Lebensfähigkeit von >80%, mit einer Erntedichte von 2,5-3,5 × 10 5 pro cm². Für die CASY-Zählung sollte der Aggregationsfaktor (AGG) <2,1 gemäß den Einstellungen für hiPSCs, die mit Accutase dissoziiert sind, aus den Anweisungen des Herstellers betragen.

16. Verdünnen der Zellsuspension mit FTDA mit Y-27632. Geltrex-Lösung von den beschichteten Platten absaugen und Zellen mit einer Aussaatdichte von 4,5-7 × 10 4 Zellen pro cm² Oberfläche ausplattieren.

Platte, z. B. 400.000-650.000 Zellen in 2 ml FTDA pro 9,6 cm² (eine Platte mit sechs Vertiefungen). Je nach Saatdichte ist die nächste Passage nach 3-5 Tagen notwendig.

17. Inkubieren bei 37 °C, 90 % rF, 5 % CO2 und 5% O2und Dokumentdaten.

Die Datendokumentation umfasst Lebensfähigkeit, Aggregationsfaktor, Zellzahl und Morphologie.

18. Um p12-p15 herum skaliere die Kultur von Sechs-Well-Platten auf T75-Kolben.

Füttern Sie je nach Konfluenz mit 15-30 ml FTDA (siehe Schritte 7 und 8) und verwenden Sie 7 ml Accutase, um die Zellen für den Transfer in den Kolben abzulösen (siehe Schritt 12).

Dieser Abschnitt beschreibt das Einfrieren einer Master Cell Bank (MCB) oder Working Cell Bank (WCB).

Materialien

  • Zwei bis vier T75-Kolben mit konfluenten (90%-100%) hiPSCs bei p18-p25 (Basisprotokoll 1)
  • Fetales Rinderserum, fortgeschritten (FBS Capricorn Scientific GmbH FBS-11A)
  • Accutase-Lösung mit Y-27632 (siehe Rezept)
  • Waschmedium (siehe Rezept)
  • Gefriermedium (siehe Rezept)
  • Pasteurpipetten, steril, autoklaviert
  • Inkubator mit CO2 und N2 Gasversorgung mit einem O2 Regelsystem eingestellt auf 37 °C, 90 % relative Luftfeuchtigkeit (rH), 5 % CO2, 5% O2 (hypoxischer Zustand)
  • 50 ml konisches Zentrifugationsröhrchen
  • Kryoflaschen
  • Kryogene Aufbewahrungsetiketten oder ethanolbeständige Marker
  • Gefrierbehälter mit Isopropanol oder Gefriermaschine
  • Gefrierschrank, −80 °C und −150 °C (oder Flüssigstickstofftank)

Kryokonservierung von MCB

Die unten aufgeführten Volumina sind für einen T75-Kolben geeignet. Bei Sechs-Well-Platten entsprechend der Wachstumsoberfläche anpassen. Zwei T75 führen normalerweise zu 25-30 Kryovials mit jeweils 1 Million hiPSCs.

1. Bilden Sie die Zellmorphologie kurz vor der Ernte für MCB ab und dokumentieren Sie.

2. Medium mit einer sterilen, autoklavierten Pasteurpipette für jede Zelllinie ansaugen. Mit 10 ml PBS pro T75-Kolben waschen.

3. 7 ml Accutase mit Y-27632 zugeben und 7-10 min im Brutschrank inkubieren.

Inkubieren Sie, bis sich die Zellen vollständig ablösen, ohne zu kratzen oder zu klopfen.

4. Zellen in 10 ml Waschmedium resuspendieren. Zellen in konischem 50-ml-Zentrifugenröhrchen für 3 min bei 200 × zentrifugieren g, Zimmertemperatur.

5. Überstand absaugen, Pellet durch Klopfen auf den Boden des konischen Zentrifugationsröhrchens lösen und vorsichtig in 2-3 ml FBS resuspendieren.

6. Zellen in CASY oder manuell mit Neubauer-Kammer zählen.

Zellzahlziele: AGG <2.1, Lebensfähigkeit zum Einfrieren >90%, Erntedichte etwas niedriger als beim Passieren, zwischen 1,5 und 2,0 × 10 5 pro cm 2 , um eine exponentielle Wachstumsphase sicherzustellen. Aliquotprobe für den Pluripotenzmarkertest an frischen Zellen.

Die Frischzellpopulation kurz vor dem Einfrieren sollte untersucht werden, da sich die Expression von Oberflächenmarkern während des Einfrierens/Auftauens ändern kann (siehe Erwartete Ergebnisse).

7. Berechnen Sie die Menge an Einfriermedium, die erforderlich ist, um eine Endkonzentration von 1 Million Zellen pro 1 ml Einfriermedium zu erhalten.

8. Bereiten Sie im Voraus frisches Gefriermedium (10 % DMSO/90 % FBS) in einem zusätzlichen Röhrchen vor.

Berechnen Sie die FBS-Menge einschließlich der Menge, die für die Vorsuspension in Schritt 5 verwendet wurde, so dass die Endkonzentration von DMSO 10 % beträgt. Fügen Sie 10 % mehr für das Pipettiervolumen hinzu.

9. Fügen Sie den Zellen Gefriermedium hinzu. Invertieren und sehr vorsichtig pipettieren und sofort in beschriftete Kryoröhrchen aliquotieren.

Ziehen Sie in Erwägung, gedruckte Etiketten zu verwenden. Der vollständige Zelllinienname mit Klonnummer, Passagennummer, MCB/WCB und Einfrierdatum sollte erscheinen.

10. MCB-Fläschchen im Gefrierbehälter in einen –80°C Gefrierschrank überführen und über Nacht ruhen lassen. Am nächsten Tag auf −150 °C oder flüssigen Stickstoff übertragen.

Der Gefrierbehälter ermöglicht ein schrittweises Einfrieren bei −1 °C pro Minute im −80 °C-Gefrierschrank für die ersten 24 Stunden. Vermeiden Sie es, den Behälter während des Gefriervorgangs im Gefrierschrank zu bewegen. Alternativ kann eine Gefriermaschine mit geregelter Geschwindigkeit verwendet werden.

11. Dokumentieren Sie alle Daten in einer Datei und bereiten Sie Detailinformationen in der Speicherliste vor.

Informationsredundanz ist hilfreich, um Fehler zu erkennen, z. B. bei der Nummerierung.

Kryokonservierung von WCB

12. Tauen Sie 1 Fläschchen des MCB auf, expandieren Sie weiter für 3-5 Passagen und kryokonservieren Sie es als WCB, indem Sie die Schritte 1-11 und die Qualitätskontrollen wiederholen, wie in Abbildung 3 angegeben (siehe Unterstützungsprotokolle 1-4).

Die Qualitätskontrollen umfassen den Nachweis von Pluripotenz, Potenz, Sterilität, Lebensfähigkeit, Transgen-Clearance und genetischer Stabilität (Abb. 3). Je nach Projektanforderung sollten weitere Charakterisierungsformen hinzugefügt werden.

1: BEWERTUNG VON STAMMZELLENMARKERN DURCH FLUSSZYTOMETRIE

Die quantitative Lebendfärbung von Oberflächenmarkern von Stammzellen und die Selbsterneuerung können durch Durchflusszytometrie durchgeführt werden. Um repräsentative Ergebnisse zu erhalten, nehmen Sie entweder frische hiPSCs während der Zellernte für MCB oder ernten Sie mindestens zwei Passagen nach dem Auftauen (siehe Erwartete Ergebnisse).

Materialien

  • hiPSCs (Basisprotokoll 1 oder 2)
  • FACS-Puffer (siehe Rezept)
  • FITC Maus Anti-Human TRA-1-60 (Becton Dickinson Kat.-Nr. 560876)
  • FITC Maus-IgM, Isotypkontrolle (Becton Dickinson Kat.-Nr. 553474)
  • PE Anti-SSEA3 (Becton Dickinson Kat.-Nr. 560879)
  • PE Rat IgM, Isotypkontrolle (Becton Dickinson Kat.-Nr. 553943)
  • Durchflusszytometrieröhrchen kompatibel mit Durchflusszytometer
  • Durchflusszytometer und Software: z. B. Canto II Durchflusszytometer und Becton Dickinson FACSDiva Software 6.0

Lebendzellfärbung für SSEA3 und TRA-1-60

1. 1 Million hiPSCs in 1 ml FACS-Puffer resuspendieren und 15 min auf Eis inkubieren.

Verarbeiten Sie die Färbung so schnell wie möglich, um den Zelltod zu minimieren. Lagern Sie hiPSCs bei Bedarf bis zu 2 Tage in 100 % FBS bei 4 °C oder auf Eis.

2. Teilen Sie die Zellprobe in zwei Durchflusszytometrieröhrchen auf.

3. 3 min bei 200 × zentrifugieren g, 4°C, und verwerfen Sie den Überstand.

4. Fügen Sie entweder PE-Anti-SSEA3- oder FITC-Maus-Anti-Human-TRA-1-60-Antikörper, verdünnt in 100 µl FACS-Puffer, oder die entsprechenden Isotyp-Kontrollantikörper hinzu.

Die geeigneten Verdünnungen der Antikörper hängen von den vom Hersteller empfohlenen Arbeitskonzentrationen für die Chargenverwendung ab.

5. Vortexen Sie bei niedriger Geschwindigkeit, um hiPSCs zu resuspendieren. Inkubieren Sie mindestens 30 Minuten auf Eis oder bei 4°C.

6. 2 ml FACS-Puffer zugeben, 5 min bei 200 × zentrifugieren g, 4°C, und verwerfen Sie den Überstand.

7. Wiederholen Sie Schritt 6 zweimal mit 2 ml PBS.

8. In endgültigem PBS-Volumen resuspendieren, das für die FACS-Analyse ausreichend ist (z. B. 250 µl).

9. Analysieren Sie die Proben durch Durchflusszytometrie.

In unseren Händen zeigen die meisten hiPSC-Linien >90% SSEA3-positive Zellen (siehe Erwartete Ergebnisse). Zelllinien mit zwischen 70 % und 90 % SSEA3-Positivität, immer noch gut differenzierte hiPSC-Linien mit < 40 % SSEA3-Positivität wurden verworfen.

2: KONTROLLE AUFTAUEN – LEBENSDAUER UND STERILITÄT

Kontrolliert die Lebensfähigkeit, ermöglicht die hiPSC-Wiederherstellung und testet auf bakterielle und Pilzkontamination (Abb. 4). Wir empfehlen, zwei Fläschchen aufzutauen, um die Zuverlässigkeit des Einfriervorgangs zu überprüfen (Hunt, 2019).

Materialien

  • Zwei MCB-Kryovials (siehe Basisprotokoll 2, Schritt 10)
  • Sechs-Well-Platten, beschichtet mit Geltrex (siehe Rezept)
  • FTDA mit Y-27632 (siehe Rezept)
  • Mikroskop mit Kamera zur Dokumentation
  • Material für Mycoplasma-PCR (siehe Tabelle 1 und Breckwoldt et al., 2017 )
Gen oder andere Sequenz Funktion Vorwärts-Primersequenz (5′-3′) Reverse Primersequenz (5′-3′)
GUSB Housekeeping-Gen AAACGATTGCAGGGTTTCAC CTCTCGTCGGTGACTGTTCA
Sendai-Virus Umprogrammierungsvektor GGA TCA CTA GGT GAT ATC GAG C ACC AGA CAA GAG TTT AAG AGA TAT GTA TC
Mykoplasmen Bakterielle Kontamination TGC ACC ATC TGT CAC TCT GTT AAC CTC ACT CCT ACG GGA GGC AGC AGT A
NANOG Pluripotenz endogen GATTTGTGGGCCCTGAAGAAA AAGTGGGTTGTTTGCCTTTG
SOX2 Pluripotenz endogen AGTCTCCAAGCGACGAAAAA TTTCACGTTTGCAACTGTCC
BRACHYURY (TBXT) Mesoderm TGCTTCCCTGAGACCCAGTT GATCACTTCTTTCCTTTGCATCAAG
TNNT2 Mesoderm TTTGGTTTGGACTCCTCCAT CTGGAGAGAGGACGAAGACG
SOX17 Endodermie CGCACGGAATTTGAACAGTA GGATCAGGGACCTGTCACAC
AFP Endodermie AGAACCTGTCACAAGCTGTG GACAGCAAGCTGAGGATGTC
FOXA2 Endodermie GAGCGGTGAAGATGGAAGG TGTACGTGTTCATGCCGTT
TUBB3 Ektoderm GGCCAAGGGTCACTACACG GCAGTCGCAGTTTTCACACTC
PAX6 Ektoderm TGGGCAGGTATTACGAGACTG ACTCCCGCTTATACTGGGCTA
SOX1 Ektoderm ACCAGGCCATGGATGAA CTTAATTGCTGGGGAATTGG
NCAM1 Ektoderm ATGGAAACTCTATTAAAGTGAACCTG TAGACCTCATACTCAGCATTCCAGT

Zellen auftauen

1. Bereiten Sie zwei separate Geltrex-beschichtete Sechs-Well-Platten vor: eine Sterilitätskontrollplatte mit einem Sechs-Well pro Klon und eine Viabilitätskontrollplatte mit zwei Sechs-Well-Platten pro Klon.

2. Zwei MCB-Kryovials separat auftauen, wie in Basic Protocol 1, Schritte 1-5 beschrieben, Zellen in jeweils 2,3 ml FTDA mit Y-27632 resuspendieren (Fig. 4A).

3. Auf der Viabilitätskontrollplatte 2 ml von jedem MCB-Kryovial in jede Vertiefung plattieren.

4. Auf der Sterilitätskontrollplatte die restlichen 300 µl aus beiden Fläschchen sammeln und 1 ml FTDA mit Y-27632 hinzufügen.

Lebensfähigkeitskontrolle

5. Dokumentenwiederherstellung durch Fotografieren der Zelldichte der Lebensfähigkeitskontrollplatte.

Abhängig von ihrer Konfluenz nach dem Auftauen kann es wünschenswert sein, die hiPSCs in Zukunft in eine größere Anzahl von Wells zu plattieren, oder die MCB-Produktion muss möglicherweise wiederholt werden (Abb. 4B).

6. Füttern Sie hiPSCs täglich und ziehen Sie in Erwägung, sie einer weiteren Analyse zu unterziehen (Unterstützungsprotokolle 3 und 4.

Kontrolle auf bakterielle und pilzliche Kontamination einschließlich Mykoplasmen

7. Kontrollieren Sie 10 Tage lang regelmäßig auf bakterielle Kontamination, ohne das Medium zu wechseln, indem Sie die Farbe des Mediums und die potenzielle Bakterienbewegung unter dem Mikroskop bei hoher Vergrößerung sowie die Wachstumsgeschwindigkeit und Morphologie von hiPSCs überwachen.

Normalerweise wachsen bakterielle Verunreinigungen schnell und sind nach 2-3 Tagen deutlich sichtbar, aber langsam wachsende Bakterien (z. B. Stenotrophomonas maltophilia oder Burkholderia cepacia) können nach 10 Tagen sichtbar werden. Wir empfehlen generell nicht, Antibiotika in hiPSC-Kulturen zu verwenden.

8. Optional: Überstand zur Sterilitätsprüfung schicken.

Krankenhaushygieneabteilungen bieten standardisierte Tests und Einblicke in die Arten der bakteriellen Kontamination, die helfen können, wiederkehrende schwere Infektionen zu vermeiden.

9. Nach 72 Stunden Probenmediumüberstand zum Nachweis von Mykoplasmen durch PCR, wie von Breckwoldt et al. ( 2017 ) oder mit einem alternativen kommerziell erhältlichen Mykoplasmen-Nachweistest.

Auch nach dem Auftauen junger Klone und während der Expansion wird dringend empfohlen, auf eine mögliche Mykoplasmenkontamination zu testen. Probenmediumüberstand von vollständig konfluenten hiPSCs, um sicherzustellen, dass die Nachweisschwelle erreicht wird.

Die Spezifität und Sensitivität von Mykoplasmentests variiert und sollte validiert werden (Nikfarjam et al., 2012). Der in diesem Protokoll spezifizierte Sterilitätstest stellt sicher, dass Zellkulturen im Allgemeinen aseptisch sind. Dies garantiert jedoch keine Sterilität (Fleming et al., 2006).

3: POTENZ, VIRALE Clearance UND PLURIPOTENZ – SPONTANE DIFFERENZIERUNG UND qRT-PCR

Das Protokoll kombiniert die einfache Embryoide Body (EB)-Bildung mit Collagenase- (El-Mounayri et al., 2013) und FBS-basiertem Spontandifferenzierungsmedium (Abb. 5). Die Potenz von hiPSCs hinsichtlich der Differenzierung in die drei Keimblätter wird mittels qRT-PCR untersucht (siehe Tabelle 1 Bertero et al., 2016 Breckwoldt et al., 2017 Schaaf et al., 2014 ). Die cDNA wird auch verwendet, um die virale Clearance zu überprüfen. Darüber hinaus kann die qRT-PCR mit endogenen Pluripotenzfaktoren verwendet werden, um Marker für den Stammzellstatus und die Selbsterneuerung besser zu beurteilen.

Materialien

  • Zweimal passagierte, fast konfluente (90 % – 100 %) hiPSCs, die von MCB aufgetaut wurden (Basisprotokoll 2, Schritt 10)
  • Collagenase II-Lösung (siehe Rezept)
  • EB Waschmedium (siehe Rezept)
  • Pluronic ® -127-beschichtete T25-Suspensionskulturflasche oder zwei Wells einer 6-Well-Platte (siehe Rezeptur)
  • EB Differenzierungsmedium (siehe Rezeptur)
  • RNA-Isolationskit (z. B. RNeasy Plus Mini Kit, Qiagen 74134)
  • cDNA-Reverse-Transkriptions-Kit (z. B. High Capacity cDNA RT Kit, Applied Biosystems)
  • Spezifische Primer (siehe Tabelle 1)
  • qPCR-Mix mit Carboxyrhodamin (ROX z. B. Eva Green qPCR-Mix, Solis BioDyne)
  • 50 ml konische Zentrifugenröhrchen
  • Flüssigstickstoff
  • Nanodrop TM ND-1000 Spektralfotometer (ThermoFisher Scientific)
  • qPCR-Gerät (z. B. ABI PRISM 7900HT Sequence Detection System, Applied Biosystems)

EB-basierte spontane Differenzierung

1. Kultivieren Sie hiPSCs auf 90-100 % Konfluenz.

Die Fütterung mit FTDA 1-4 Stunden vor Beginn der Dissoziation verbessert die EB-Bildung.

2. Medium absaugen und in 1 ml Collagenase-Lösung 45 min bis 2 h inkubieren, bis sich die Zellschicht in großen Mengen von der Oberfläche abhebt.

3. Überführen Sie die Zellsuspension in ein konisches 50-ml-Zentrifugationsröhrchen.

4. Spülen Sie die Wells mit 1 ml EB-Waschmedium und geben Sie sie in ein konisches Zentrifugationsröhrchen.

5. Lassen Sie die Zellklumpen sedimentieren und entfernen Sie den Überstand (erster Waschschritt).

6. 4 ml EB-Waschmedium zugeben und 3 min bei 200 × zentrifugieren g, Zimmertemperatur.

7. Entfernen Sie den Überstand und lösen Sie das Pellet auf, indem Sie mit einem Finger auf die konische Zentrifugation klopfen. 4 ml Differenzierungsmedium zugeben.

Bei Bedarf die Zellen vorsichtig mit einer 5-ml-Pipette verreiben, um die Zellbrocken in kleinere Cluster aufzubrechen (vergleiche Abb. 5A).

8. 3 ml Zellsuspension in einen zuvor mit Pluronic ® F127 beschichteten und gewaschenen T25-Kolben überführen.

9. Überführen Sie die verbleibende Zellsuspension in ein 1,5-ml-Röhrchen als Probe von Tag 0. Überstand nach kurzer Zentrifugation entfernen, Zellpellet in flüssigem Stickstoff einfrieren und bei -80 °C lagern.

10. T25-Kolben bei 37 °C, 90 % rF, 5 % CO . inkubieren2 unter normoxischen Bedingungen. Die Zellaggregation führt über Nacht zu embryoiden Körpern (Fig. 5B).

11. Medium mit EB-Differenzierungsmedium alle 2-3 Tage für 7 Tage wechseln.

12. An Tag 7 eine Probe von EBs entnehmen und in ein konisches Zentrifugationsröhrchen überführen. Lassen Sie dieses sedimentieren und entfernen Sie den Überstand, so dass nur etwa 1 ml Medium mit EBs übrig bleibt. In ein beschriftetes 1,5-ml-Röhrchen überführen. Zentrifugieren Sie 1 min bei 300 × g, Zimmertemperatur. Überstand entfernen, Zellpellet in flüssigem Stickstoff schnell einfrieren und bei -80 °C lagern.

RT-qPCR für Keimschichtmarker, Virusclearance und Stammzellmarker

13. RNA isolieren und in cDNA transkribieren.

Verwenden Sie beispielsweise das RNeasy Plus Mini Kit und die High Capacity cDNA Reverse Transcription gemäß den Anweisungen des Herstellers. Messen Sie die RNA-Konzentration und -Reinheit mit einem Nanodrop-Spektrophotometer.

14. Führen Sie RT-qPCR mit Primern für Marker jeder Keimschicht, für endogene Pluripotenzgene (wie in Tabelle 1 aufgeführt) und für die Neuprogrammierung von Virusprimern gemäß den Anweisungen des Herstellers durch.

Fügen Sie negative Kontrollen ohne Zugabe von reverser Transkriptase hinzu, um potenzielle genomische Artefakte zu erkennen. Als Positivkontrollen auch Proben von differenzierten Zellen, hiPSC und transduzierten Fibroblasten einschließen.

15. Normalisieren Sie die Expression auf das Haushaltsgen und bewerten Sie die Expression differenzierter Zellen als hiPSC-Faltung (Tag 0).

Mindestens ein Marker aller drei Keimblätter sollte an Tag 7 gegenüber Tag 0 hochreguliert und Marker für Stammzellen und Selbsterneuerung herunterreguliert werden. Sendai-Virus sollte nur in transduzierten Fibroblasten nachweisbar sein.

Klone sollten transgenfrei sein, bevor funktionelle Experimente durchgeführt werden. Müssen Qualitätskontrollen in einem Labor mit Biosafety Level 1 (BSL1) durchgeführt werden, kann es sinnvoll sein, die Virusclearance während der Expansion zu verifizieren, da die Transgenclearance-Verifizierung Voraussetzung für den Einsatz von S1 ist.

4: IDENTITÄT – KURZE TANDEM-WIEDERHOLANALYSE

Vergleichen Sie für den Identitätstest (Abb. 6) das Short-Tandem-Repeat (STR)-Profil der Probandenprobe (z. B. genomische DNA, die aus Buffy Coats von Blut oder Wangenabstrich oder konservierten Primärzellen isoliert wurde) mit dem der MCB-hiPSCs. Das Unterscheidungsvermögen dieser kombinierten STR-Loci ist hoch genug, um alle Menschen außer eineiigen Zwillingen zu unterscheiden.

Materialien

  • Probandenprobe (z. B. Wangenabstrich)
  • MCB-Kryoröhrchen (Basisprotokoll 2, Schritt 10)
  • Chelex 100 ® Harz (Bio-Rad 143-2832)
  • PowerQuant™-System (Promega PQ 5008)
  • PowerPlex ESI17 Fast™ PCR-Amplifikations-Multiplex-Kit (Promega DC 1720) oder vergleichbares Kit einer anderen Firma (z. B. ThermoFisher, Qiagen oder Promega)
  • MicroAmp™ Optischer Klebefilm (Applied Biosystems 4311971)
  • HiDi Formamid (Applied Biosystems 4311320)
  • LiChrosolv Wasser für die Chromatographie (Merck 1.15333)
  • Forensische Abstriche (Sarstedt 80.634)
  • Heizung, 56°C
  • 96-Well-PCR-Platte (z. B. 96 PCR Plate Half Rock, Sarstedt 72.1979.202)
  • ABI 7500 Realtime-PCR-System
  • ABI 3130 Genanalysegerät
  • Genemapper ID 3.2 (Software zur Identifizierung der Allele)

Probenvorbereitung

1. Tauen Sie 1 Fläschchen MCB wie in Basisprotokoll 1 beschrieben auf.

Verwenden Sie ein 50-ml-Falcon-Röhrchen, um den Boden leichter zu erreichen.

2. Zentrifugieren Sie 3 min bei 200 × g, Raumtemperatur, aspirieren das Medium und entnehmen Sie die Probe mit einem Tupfer aus dem Zellpellet am Boden des Falcon-Röhrchens.

Da die Tupfer steril sind, können hiPSCs ausplattiert und für weitere Experimente verwendet werden.

DNA-Extraktion: Chelex-Methode

Chelex ® 100 ist ein Ionenaustauscherharz, das DNA-zerstörende Nukleasen durch Entfernen von Magnesium inaktiviert, die Einwirkung von 100°C die Zellmembranen und Proteine ​​aufbricht und die DNA denaturiert, was zu einzelsträngiger DNA führt (Butler, 2010 Walsh, Metzger & Higuchi, 1991) .

3. Bereiten Sie eine 5%ige Suspension von Chelex ® 100 Harz in destilliertem Wasser vor.

4. Übertragen Sie jeden Austausch (einer mit Probandenprobe, einer mit MCB-Probe) in ein 1,5-ml-Reaktionsröhrchen.

5. 500 µl Chelex ® 100 Suspension zum Tupfer im Röhrchen geben und mehrmals schütteln, um die Suspension zu mischen.

7. Entfernen Sie die Rohre vom Heizgerät und erhöhen Sie die Temperatur auf 100°C.

8. Inkubieren Sie die Röhrchen 6 min bei 100 °C.

9. Die Röhrchen kräftig vortexen und 1 min bei 200 × zentrifugieren g, Zimmertemperatur.

10. Die DNA im Überstand ist nun für die PCR bereit.

Nach der Lagerung im Kühlschrank für >24 Stunden sollte der DNA-Extrakt vor der Verwendung erneut gevortext und zentrifugiert werden.

Optional: DNA-Quantifizierung

Die sensitivste und spezifischste Methode zur Quantifizierung menschlicher DNA ist die quantitative Echtzeit-PCR (qPCR). Hier verwenden wir das PowerQuant™ System (Promega) und das ABI 7500 Real Time PCR System (ThermoFisher). Das PowerQuant™-System quantifiziert gleichzeitig die Menge der gesamten, der männlichen und der degradierten gDNA. Die DNA-Quantifizierung erfolgt nach dem Protokoll des Herstellers.

11. Bereiten Sie eine serielle Verdünnung des PowerQuant™ Male gDNA-Standards (im Lieferumfang des PowerQuant-Kits enthalten) vor.

Unser Standard besteht aus den folgenden vier Konzentrationen: 50, 2, 0,08 und 0,0032 ng/µl (nacheinander unverdünnt 4 µl 50 ng/µl + 96 µl Verdünnungspuffer = 2 ng/µl 4 µl 2 ng/µl + 96 Verdünnungspuffer = 0,08 ng/µl und 4 µl 0,08 ng/µl + 96 µl Verdünnungspuffer = 0,0032 ng/µl)

12. Bereiten Sie eine Reaktionsmischung aus PowerQuant™ 2× Master Mix, PowerQuant™ 20× Primer Mix und Wasser für die geplante Anzahl von Reaktionen plus 10 % vor. Das Reaktionsvolumen beträgt 20 µl.

Berechnen Sie den Mastermix mit DNA-Proben, acht Standardproben, negativer (keine Schablone) Kontrolle und 0,2 ng DNA 2800 M (im PowerPlex ESI17 Multiplex-Kit enthalten).

13. Geben Sie 18 µl des Reaktionsgemisches in die Reaktionsvertiefungen einer 96-Well-PCR-Platte.

14. 2 µl der gDNA-Standards, der Kontrollen und der unbekannten DNA-Proben in die entsprechenden Vertiefungen geben und die Platte mit MicroAmp Optical Adhesive Film versiegeln. Platte kurz zentrifugieren.

Verwenden Sie zwei technische Replikate für alle Proben.

15. Starten Sie den Thermocycling-Lauf gemäß den Anweisungen des Herstellers.

16. Die Analyse der Rohdaten erfolgt mit der HID Real Time PCR Software die Daten werden anschließend in das PowerQuant Analysis Tool importiert und dort gespeichert.

PCR-Amplifikation von STR-Loci mit PowerPlex ESI17 Fast™ Multiplex-Kit (Promega)

  • 17. Bereiten Sie eine Reaktionsmischung vor:
  • 2 µl 5× Mastermix inklusive Taq Polymerase
  • 1 µl 10× Primer-Mix
  • 0,5 ng Template-DNA

Wasser (Amplifikationsgrad) nach Bedarf auf 10 µl.

Die optimale Menge an Template-DNA zur Erzeugung ausgewogener STR-Profile beträgt 0,5 ng der gesamten Template-DNA.

17. Führen Sie die PCR im Thermocycler für 29 Zyklen gemäß dem Protokoll des Herstellers durch

18. Lagern Sie amplifizierte Proben bei 4 °C, bis sie zur Durchführung der Kapillarelektrophorese bereit sind

Kapillarelektrophorese der PCR-Produkte auf dem ABI 3130 Genetic Analyzer

An den Primern und am Größenstandard sind fünf verschiedene Fluoreszenzfarbstoffe angebracht. Die unterschiedlichen Fragmentlängen der STR-Allele und die Verwendung unterschiedlicher Fluoreszenzfarbstoffe ermöglichen den gleichzeitigen Nachweis aller Loci und Allele in einem einzigen Durchlauf. Die Kapillaren sind 36 cm lang und werden nach jedem Lauf mit einem speziellen Polymer zur Trennung der Allele nachgefüllt.

19. Jede amplifizierte Probe durch Zugabe von 30 µl LiChrosolv ® Wasser verdünnen.

20. Bereiten Sie eine Formamid-Größenstandard-Mischung vor (1000 µl HIDI-Formamid + 30 µl Größenstandard)

Allelleiter ESI17, Größenstandard WENILS500ESS, kann verwendet werden, wenn das PowerPlex ESI17 Multiplex-Kit verwendet wird.

21. Fügen Sie 13 µl dieser Mischung zu der Anzahl der Wells einer 96-Well-Platte hinzu, die für die amplifizierten Proben und die Allelleiter benötigt werden. Fügen Sie 2 µl jedes PCR-Produkts und 2 µl der Allelleiter hinzu.

22. Die Platte 3 min bei 94 °C inkubieren und dann 3 min in einem Gefrierschrank bei -18 °C abkühlen.

23. Lassen Sie die Platte im ABI 3130 Genetic Analyzer gemäß den Herstellerprotokollen laufen.

24. Analysieren Sie die Rohdaten mit der Software Genemapper ID 3.2.


Hintergrund

Es ist bekannt, dass die Zahnmorphogenese durch die zellulären Interaktionen zwischen Ektoderm-abgeleiteten oralen Epithelzellen und Neuralleisten-abgeleiteten Mesenchymen initiiert wird [1,2], und Stammzellforschungen zur Erzeugung von Osteoblasten und Neuronen wurden ausgiebig unter Verwendung von Stammzellen aus Zahngewebe mit solchen aus der Neuralleiste stammenden Ektomesenchym-Ursprung [3-5]. Bis heute wurden verschiedene postnatale Stammzellen erfolgreich aus dem entnommenen Zahngewebe wie Zahnpulpa, Parodontalband und Zahnpapille durch nicht-invasive Gewinnungsverfahren isoliert [3,6,7]. Während der Zahnentwicklung ist bekannt, dass Dentin- und Pulpagewebe aus Zahnpapillen entwickelt werden, wobei die Zahnpapille offensichtlich einen Pool von Stammzellen mit hoher Regenerationsfähigkeit aufweist [8,9], und die Mehrheit der Stammzellen in der Zahnpapille wurde Es wurde berichtet, dass es von einem von der Neuralleiste abgeleiteten Ektomesenchym stammt [10]. Aufgrund dieses entwicklungsbedingten Ursprungs, der relativ leichten Zugänglichkeit der Stammzellquelle aus verworfenem Zahn und der möglichen autologen Implantation durch Kryokonservierung in einer dentalen Stammzellbank, wurde Zahnpapille als potente Stammzellquelle in der regenerativen Medizin vorgeschlagen. Im Bereich des Tissue Engineering und der regenerativen Medizin wurden beispielsweise biotechnologisch hergestellte Zähne mit der richtigen Zahnstruktur aus Stammzellen aus molarem Zahnkeimgewebe entwickelt [11], in vivo Knochenbildung könnte durch Transplantation von gewebetechnisch hergestelltem Knochengewebe erzeugt werden, das aus kryokonservierten dentalen Stammzellen gebildet wurde [12,13], und es wurde berichtet, dass die Erzeugung funktioneller Neuronen aus dentalen Stammzellen unter neuralen induktiven Reizen erfolgt [14].

Trotz der hohen Anwendbarkeit von Stammzellen aus Zahngewebe in Tissue Engineering und regenerativer Medizin wurde jedoch die Mykoplasmenkontamination der primären kultivierten Stammzellen aus Zahngeweben, die leicht durch orale Bakterien infiziert werden können, übersehen und die Bewertung und Entfernung infizierter Mykoplasmen in dentalen Stammzellen müssen hinsichtlich der biologischen Sicherheit in dentalen Stammzellen Anwendungen in der regenerativen Medizin berücksichtigt werden. Es wurde berichtet, dass fast menschliches Mundgewebe häufig mit kleinen Mikroorganismen wie Mykoplasmen infiziert war [15], und viele Arten von Bakterien verursachen Mundhöhlen in Zähnen, und Mykoplasmen, die kleinsten und einfachsten sich selbst replizierenden Organismen, sind bekannt als eines der wichtigsten Bakterien in der Mundhöhle [16]. Postnatale Stammzellen aus infiziertem Zahngewebe sind offensichtlich mit Mykoplasmen infiziert, und eine solche Mykoplasmeninfektion in Zahngeweben könnte das Verhalten von Stammzellen aus Zahngewebe einschließlich der Zellproliferation beeinflussen. Es ist bekannt, dass eine Mykoplasmeninfektion die Zellproliferation, Chromosomenaberrationen in Zellen beeinflusst und immunologische Reaktionen auslöst [17,18]. Daher wurden in dieser Studie postnatale Stammzellen hauptsächlich aus apikalen Papillen des dritten Molaren und Prämolaren von verschiedenen älteren Patienten isoliert und kultiviert, die sich einer kieferorthopädischen Therapie unterzogen, und die Mykoplasmenkontamination wurde für jede isolierte Stammzelle aus apikaler Papille (hSCAPs) von humanen Zähne. Die Zellproliferationskapazität wurde auch mit Mykoplasmen-infizierten und -eliminierten hSCAPs getestet, und dann wurden 2D- und 3D-osteogene und neurale Differenzierungskapazitäten von Mycoplasma-eliminierten hSCAPs für die potente Anwendung auf Knochen- und Nervengewebe-Engineering bewertet (Abbildung 1 I).

Schematische Darstellung der Anwendungen von hSCAPs zur Knochen- und neuralen Gewebezüchtung und Charakterisierung von primär kultivierten hSCAPs. ich. Schematische Darstellung der Knochen- und Neuraldifferenzierung von Mykoplasmen eliminierten hSCAPs für das Knochen- und Neuralgewebe-Engineering. II. Morphologie und immunzytochemische Bilder der primären kultivierten Stammzellen aus apikaler Papille (hSCAPs). EIN. Zellauswuchs aus apikalem Papille-Gewebefragment. B. Erweiterte hSCAPs. C. Stro-1 (grün) und Kernfärbung (DAPI blau). D. CD44 (rot) und Kernfärbung (DAPI blau). E. SEM-Aufnahme der expandierten hSCAPs in Gegenwart von NGF, FGF2 und LIF. F. CD44 (grün) und Kernfärbung (DAPI blau) der expandierten hSCAPs in Gegenwart von NGF, FGF2 und LIF. g. Nestin (grün) und Kernfärbung (DAPI blau) der expandierten hSCAPs in Gegenwart von NGF, FGF2 und LIF. h. CD133 (rot) und Kernfärbung (DAPI blau) der expandierten hSCAPs in Gegenwart von NGF, FGF2 und LIF.


Zellkultur: Top 9 Wissenswertes über Zellkultur

Dieser Artikel beleuchtet die neun Dinge, die Sie über Zellkultur wissen müssen.

Die neun Dinge sind: (1) Was ist Zell- und Gewebekultur? (2) Ausrüstung für die Zellkultur (3) Subkultivierung von Zellen (4) Zellquantifizierung (5) Tierische Zellkultur (6) Wie werden Zellkulturen für die Kultur gewonnen? (7) Eigenschaften kultivierter Zellen (8) Probleme kultivierter Zellen und (9) Wie man entscheidet, ob kultivierte Zellen „glücklich“ sind.

Sache Nr. 1. Was ist Zell- und Gewebekultur?

Gewebekultur ist der allgemeine Begriff für die Entfernung von Zellen, Geweben oder Organen aus einem Tier oder einer Pflanze und deren anschließende Platzierung in einer künstlichen Umgebung, die dem Wachstum förderlich ist.

Diese Umgebung besteht normalerweise aus einem geeigneten Kulturgefäß aus Glas oder Kunststoff, das ein flüssiges oder halbfestes Medium enthält, das die für das Überleben und das Wachstum wesentlichen Nährstoffe liefert.

Die Kultur ganzer Organe oder intakter Organfragmente mit der Absicht, ihre weitere Funktion oder Entwicklung zu untersuchen, wird als Organkultur bezeichnet. Wenn die Zellen vor oder während der Kultivierung aus den Organfragmenten entfernt werden und dadurch ihre normalen Beziehungen zu Nachbarzellen stören, wird dies als Zellkultur bezeichnet. Im Allgemeinen werden drei Arten von Kultur durchgeführt. Sie sind tierische Zellkultur, pflanzliche Zellkultur und mikrobielle Kultur.

Sache # 2. Ausrüstung für die Zellkultur:

Dazu gehören eine Gewebekulturhaube, Inkubatoren, Autoklaven und Mikroskope.

1. Zellkulturhauben:

Dies ist das zentrale Stück, da es der Ort ist, an dem die gesamte Zellenhandhabung durchgeführt wird. Diese Hauben sollen nicht nur die Kultur vor dem Bediener schützen, sondern auch den Bediener vor den Kulturen schützen. Sie werden im Allgemeinen als Laminar-Flow-Hauben bezeichnet, da sie einen glatten, ununterbrochenen stromlinienförmigen Strom (Laminar-Flow) von steriler Luft erzeugen, die durch einen hocheffizienten Partikelluftfilter (HEPA) gefiltert wurde. Es gibt zwei Arten von Laminar-Flow-Hauben, die als vertikal oder horizontal klassifiziert sind.

Die horizontale Haube lässt die Luft direkt zum Bediener strömen und wird daher im Allgemeinen für nicht infektiöse Arbeiten wie Medienaufbereitung usw gefiltert, bevor es in die Umgebung gelangt.

Derzeit werden drei verschiedene Haubenklassen verwendet, die der Kultur, dem Bediener oder beiden unterschiedliche Schutzniveaus bieten.

Diese Hauben haben zusammen mit der Klasse II einen Bildschirm an der Vorderseite, der als Barriere zwischen Kultur und Bediener fungiert, aber dennoch den Zugang zur Kultur durch eine Öffnung am unteren Rand des Bildschirms ermöglicht. Dies führt zu einer zu starken Turbulenz der Außenluft und bietet auch einen guten Schutz für den Bediener. Diese Hauben sind für den Einsatz mit Organismen mit geringem Risiko geeignet und wenn nur der Schutz des Bedieners erforderlich ist.

Dies sind die am häufigsten verwendeten Hauben. Im Gegensatz zur Klasse I wird die von außen angesaugte Luft durch das Gitter vor dem Arbeitsbereich geleitet und durch den HEPA-Filter oben in der Haube gefiltert, bevor sie über die Gewebekultur strömt. Dieser Mechanismus schützt nicht nur den Bediener, sondern stellt auch sicher, dass die Luft über der Kultur weitgehend steril ist. Die Hauben sind für Tierzellkulturen geeignet, die geringe bis mäßige toxische oder infektiöse Stoffe beinhalten, werden jedoch nicht für die Verwendung mit Krankheitserregern mit hohem Risiko empfohlen.

Diese sind erforderlich, wenn ein Höchstmaß an Bediener- und Produktschutz erforderlich ist. Diese Hauben sind vollständig abgedichtet und bieten zwei Handschuhtaschen, durch die der Bediener mit Material im Schrank arbeiten kann. Somit ist der Bediener vollständig abgeschirmt, wodurch Hauben der Klasse III für den Einsatz mit hohem Risiko in Verbindung mit Kulturen geeignet sind.

Alle Hauben müssen jederzeit einen kulturfreien und sauberen Zustand aufrechterhalten, da zu viel Kultur den Luftstrom beeinträchtigen und eine Kontamination zu Infektionen führen kann. Daher müssen nur die dafür vorgesehenen Gegenstände in die Hauben eingesetzt werden, die erforderlich sind, und alle Arbeitsplätze vor und nach der Verwendung mit 70% industriellem Methylsprit (IMS) reinigen, der Bakterien- und Pilzsporen durch Austrocknen und Fixieren von Zellen entgegenwirkt und so eine Kontamination verhindert der Kulturen.

Einige Schränke können mit kurzwelligem ultraviolettem Licht ausgestattet sein, das verwendet werden kann, um das Innere der Haube zu bestrahlen und Mikroorganismen abzutöten. Falls vorhanden, schalten Sie das UV-Licht 15 min vor der Arbeit ein, um den Arbeitsplatz zu sterilisieren. Da UV-Strahlung schädliche Wirkungen auf Haut und Augen haben kann, müssen stets Vorkehrungen getroffen werden, dass der Bediener nicht direkt mit UV-Strahlen in Berührung kommt. Zusätzlich die Haube immer mindestens 10 min vor Arbeitsbeginn einschalten, damit sich der Luftstrom stabilisieren kann.

2. CO2 Inkubatoren:

Inkubatoren mit Wassermantel sind erforderlich, um ein optimales Zellwachstum unter streng aufrechterhaltenen und regulierten Bedingungen zu ermöglichen, die normalerweise eine konstante Temperatur von 37 °C und eine Atmosphäre von 5-10 % CO . erfordern2 plus Luft. Der Zweck von CO2 ist sicherzustellen, dass das Kulturmedium auf dem erforderlichen physiologischen pH-Wert (normalerweise 7,2-7,4) gehalten wird.

Dies wird durch die Zufuhr von CO . erreicht2 durch Glaszylinder in den Brutschrank durch eine Wand, die zum Ansaugen von CO . ausgelöst wird2 wenn der Pegel unter den eingestellten Pegel fällt. Das CO2 das eindringt, löst sich im Kulturmedium auf und enthält Bicarbonat.

Letztere reagiert mit H + aus dem Zellstoffwechsel zu Kohlensäure, die mit Wasser und CO . im Gleichgewicht steht2, wodurch der pH-Wert im Medium bei ungefähr 7,2 gehalten wird. Diese Inkubatoren werden im Allgemeinen durch eine Schale mit sterilem Wasser auf dem unteren Deck befeuchtet. Die Verdunstung von Wasser erzeugt eine hochfeuchte Atmosphäre, die dazu beiträgt, die Verdunstung des Mediums aus der Kultur zu verhindern.

Eine Alternative zu befeuchteten Inkubatoren ist die trockene, unbegaste Einheit, die nicht befeuchtet ist und auf die Verwendung alternativer Puffersysteme wie 4(2-Hydroxyethyl)-l-Piperazin-Ethansulfonsäure (Hepes) oder Morpholinopropansulfonsäure (Mopps) angewiesen ist. zur Aufrechterhaltung eines ausgeglichenen pH-Wertes innerhalb des Kulturmediums. Dies hat den Vorteil, dass eine Ansteckung durch die Wasserwanne ausgeschlossen werden kann. Der Nachteil besteht jedoch darin, dass das Kulturmedium schnell verdunstet, wodurch die Zellen gestresst werden.

3. Mikroskope:

Invertierte Phasenkontrastmikroskope werden üblicherweise zur Sichtbarmachung von Zellen in Kulturmedium verwendet. Sie sind teuer, aber einfach zu bedienen, da sich die Lichtquelle oberhalb und die Objektivlinsen unterhalb des Tisches befinden, auf dem die Zellen platziert sind. Die Visualisierung von Zellen durch Mikroskopie liefert nützliche Informationen über Morphologie und Zustand der Zellen. Frühe Anzeichen von Stress können leicht erkannt und somit Vorsorgemaßnahmen getroffen werden.

4. Andere allgemeine Ausrüstung’s:

Dazu gehören Zentrifugen zum Abschleudern der Zellen, Wasserbäder zum Auftauen gefrorener Proben und Erwärmen der Medien auf 37 °C vor Arbeitsbeginn, Kühlschränke zur Aufbewahrung der Medien usw -giftige Polystyrol-Kunststoffe mit biologisch inerter Oberfläche, auf der Zellen wachsen können, stehen zur Verfügung. Hierfür stehen verschiedene Kunststoffe zur Verfügung, darunter Petrischalen, Multi-Well-Platten und Schraubkolben.

Sache Nr. 3. Subkultur von Zellen:

Es ist ein Verfahren, bei dem Zellen geerntet, in frischem Wachstumsmedium verdünnt und in eine neue Kulturflasche umgefüllt werden, um das weitere Wachstum zu fördern. Dieser Vorgang wird als Passage bezeichnet und ist unerlässlich, wenn die Zellen in einem gesunden und lebensfähigen Zustand gehalten werden sollen, da sie sonst nach einer gewissen Zeit in kontinuierlicher Kultur absterben können. Der Grund dafür ist, dass adhärente Zellen in einer kontinuierlichen Schicht wachsen, die schließlich die gesamte Oberfläche der Kulturschale einnehmen und an diesem Punkt als konfluent bezeichnet werden.

Sobald sie konfluent sind, hören die Zellen auf, sich zu teilen und gehen in einen Ruhezustand über, in dem sie aufhören zu wachsen und schließlich sterben. Um Zellen lebensfähig zu halten und eine effiziente Transformation zu erleichtern, müssen sie daher subkultiviert werden, bevor sie eine vollständige Kontakthemmung erreichen. Idealerweise sollten die Zellen geerntet werden, kurz bevor sie den konfluenten Zustand erreichen. Zellen können unter Verwendung einer von mehreren Techniken geerntet und subkultiviert werden. Die genaue Methode hängt stark davon ab, ob die Zellen in Suspension adhärent sind.

Subkultur adhärenter Zellen:

Anhaftende Zellen können entweder mechanisch, meist mit einem Gummispatel (Gummipolizist) oder enzymatisch mit proteolytischen Enzymen geerntet werden. Zellen in Suspension werden einfach in frischem Medium verdünnt, indem ein gegebenes Volumen an Zellsuspension genommen und ein gleiches Volumen an Medium hinzugefügt wird.

Mechanische Gewinnung von Zellen:

Diese Methode ist einfach und leicht. Dabei wird die Zelle mit einem Gummispatel vorsichtig von der Wachstumsoberfläche in das Kulturmedium geschabt. Diese Methode ist nicht für alle Zelltypen geeignet, da das Verschrotten zu Membranschäden und signifikantem Zelltod führen kann.

Gewinnung von Zellen mit proteolytischen Enzymen:

Mehrere verschiedene proteolytische Enzyme können genutzt werden, einschließlich Trypsin, proteolytische Enzyme, die proteinartige Verbindungen zwischen Zellen und der Oberfläche des Kolbens, in dem sie wachsen, zerstören. Infolgedessen führt die Ernte von Zellen unter Verwendung dieses Enzyms zur Freisetzung einzelner Zellen, was ideal für die Subkultivierung ist, da sich jede Zelle dann teilt und wächst, wodurch die Vermehrung von Kulturen verbessert wird.

Trypsin wird häufig mit EDTA verwendet, das die Wirkung des Enzyms verstärkt. EDTA allein kann auch beim Ablösen anhaftender Zellen wirksam sein, da es das Ca 2+ chelatisiert, das von einigen Adhäsionsmolekülen benötigt wird, die Zell-Zell- oder Zell-Matrix-Wechselwirkungen erleichtern. Obwohl EDTA allein auf den Zellen viel geschlechtsspezifischer ist als Trypsin, können einige Zelltypen stark an Plastik haften, was eine Ablösung von Trypsin erfordert.

Das Standardverfahren zum Ablösen anhaftender Zellen unter Verwendung von Trypsin und EDTA beinhaltet die Herstellung einer Arbeitslösung von 0,1% Trypsin plus 0,02% EDTA in Ca 2+ /Mg 2+ freier Phosphat-gepufferter Kochsalzlösung. Das Wachstumsmedium wird aus konfluenten Kulturen abgesaugt und mindestens zweimal mit einem serumfreien Medium wie Ca 2+ /Mg 2+ -freiem PBS gewaschen, um Serumspuren zu entfernen, die das Trypsin inaktivieren können.

Das Trypsin-EDTA wird dann zum Zellmonolayer gegeben und einige Sekunden lang herumgewirbelt. Überschüssiges Trypsin-EDTA wird abgesaugt, so dass gerade genug übrig bleibt, um einen dünnen Film über der Monoschicht zu bilden.Der Kolben wird dann 2–5 min bei 37 °C inkubiert, jedoch unter einem inversen Lichtmikroskop überwacht, wenn die Zellen beginnen, sich aufzurunden und abzulösen. Dadurch soll sichergestellt werden, dass die Zellen dem Trypsin nicht überbelichtet werden und die Zelloberfläche beschädigt werden kann.

Es ist daher wichtig, dass die Proteolysereaktion in geeigneter Weise durch Zugabe von vollständigem Medium mit Serum beendet wird, um das Enzym zu deaktivieren. Die Zellsuspension wird dann zentrifugiert und das Pellet wird in einem bekannten Volumen an vollständigem Medium resuspendiert, um eine erforderliche Zelldichte zu ergeben. Das gesamte obige Verfahren wird in einem sterilen Gewebekulturschrank durchgeführt.

Subkultur von Zellen in Suspension:

Bei Zellen in Suspension ist es wichtig, zunächst ein Aliquot der Zellen unter dem Mikroskop zu untersuchen, um festzustellen, ob die Kulturen als Einzelzellen oder als Klumpen wachsen. Wenn Kulturen als Einzelzelle wachsen, wird ein Aliquot gezählt und dann mit der gewünschten Aussaatdichte in einem neuen Kolben durch einfaches Verdünnen der Zellsuspension mit frischem Medium erneut ausgesät, vorausgesetzt, das ursprüngliche Medium wird nicht verbraucht. Zellen, die in Klumpen wachsen, sollten zuerst zentrifugiert und in frischem Medium als Einzelzelle mit einer Glaspasteur- oder Feinbordpipette resuspendiert werden.

Sache Nr. 4. Zellquantifizierung:

Es ist wichtig, dass Zellen, wenn sie subkultiviert werden, in geeigneter Dichte erneut ausgesät werden, um ein optimales Wachstum zu erleichtern. Wenn Zellen mit einer geringeren Aussaatdichte ausgesät werden, kann es länger dauern, bis die Konfluenz erreicht ist, und einige können verfallen, bevor dieser Punkt erreicht ist.

Andererseits erreichen sie, wenn sie in hoher Dichte ausgesät werden, sehr schnell Konfluenz, was zu nicht reproduzierbaren experimentellen Ergebnissen führt. Dies liegt daran, dass Trypsin Oberflächenproteine, einschließlich Rezeptoren für Medikamente, verdauen kann, und diese können einige Zeit brauchen, um sich zu erneuern. Daher ist eine geeignete Aussaatdichte ein Muss, die eine Quantifizierung der Zellen erfordert.

Dabei wird ein Hämozytometer verwendet, bei dem es sich um einen verdickten Glasobjektträger mit kleinen Gitterkammern handelt. Die Kammer hat ein festes Volumen und ist in neun große Quadrate geätzt, von denen das große Eckquadrat 16 kleine Quadrate enthält, jedes große Quadrat misst 1 mm × 1 mm und ist 0,1 mm tief. Somit repräsentiert jedes Quadrat mit aufgelegtem Deckglas ein Volumen von 0,1 mm 3 . Mit diesem Wissen kann die Zellkonzentration pro Kubikzentimeter bestimmt und ausgedrückt werden.

Ein weiteres alternatives Verfahren zur Zellquantifizierung ist die Verwendung eines elektronischen Scharzählers. Dies ist eine automatisierte Methode zum Zählen und Messen der Größe mikroskopischer Partikel. Das Instrument besteht aus einer Glassonde mit einer Elektrode, die an ein Oszilloskop angeschlossen ist. Die Sonde hat nahe ihrem unteren Ende eine kleine Öffnung mit festem Durchmesser.

Beim Eintauchen in eine Lösung der Zellsuspension werden die Zellen durch die Öffnung gespült, was zu einer kurzzeitigen Widerstandserhöhung aufgrund einer teilweisen Unterbrechung des Stromflusses führt. Dies führt dazu, dass Spikes auf dem Oszilloskop aufgezeichnet werden und jeder Spike als eine Zelle gezählt wird. Der Nachteil dieser Technik besteht darin, dass sie nicht zwischen lebenden und toten Zellen unterscheiden kann. Zellen können auch indirekt gezählt werden, indem das Gesamtzellprotein bestimmt wird und die Protein-gegen-Zellzahl-Standardkurve verwendet wird, um die Zellzahl in Testproben zu bestimmen.

Auch hier kann der DNA-Gehalt von Zellen als Indikator für die Zellzahl verwendet werden, da der DNA-Gehalt diploider Zellen normalerweise konstant ist. Der DNA-Gehalt von Zellen kann sich jedoch während des Zellzyklus ändern und gibt daher keine genaue Schätzung der Zellzahl an.

Sache Nr. 5. Tierzellkultur:

Obwohl die Tierzellkultur erstmals 1907 von Ross Harrison erfolgreich durchgeführt wurde, fanden erst Ende der 1940er bis Anfang der 1950er Jahre mehrere Entwicklungen statt, die die Zellkultur als Werkzeug für Wissenschaftler weit verbreitet machten.

Da war zunächst die Entwicklung von Antibiotika, die es einfacher machten, viele der Kontaminationsprobleme zu vermeiden, die frühere Zellkulturversuche plagten.

Zweitens war die Entwicklung der Techniken, wie die Verwendung von Trypsin, um Zellen aus Kulturgefäßen zu entfernen, notwendig, um kontinuierlich wachsende Zelllinien (wie HeLa-Zellen) zu erhalten.

Drittens konnten die Wissenschaftler mit diesen Zelllinien standardisierte, chemisch definierte Kulturmedien entwickeln, die das Züchten von Zellen erheblich erleichterten.

Durch die Kombination dieser drei Bereiche können viel mehr Wissenschaftler Zell-, Gewebe- und Organkulturen in ihrer Forschung nutzen. In den 1960er und 1970er Jahren hatte die Kommerzialisierung dieser Technologie weitere Auswirkungen auf die Zellkultur, die bis heute anhält.

Unternehmen wie Corning begannen mit der Entwicklung und dem Verkauf von Einweg-Zellkulturprodukten aus Kunststoff und Glas und verbesserten Filtrationsprodukte und -materialien, flüssige und pulverförmige Gewebekulturmedien sowie Laminar-Flow-Hauben. Das Gesamtergebnis dieser und anderer technologischer Weiterentwicklungen war eine weit verbreitete Zunahme der Zahl der Labore und Industrien, die heute Zellkulturen verwenden.

Sache Nr. 6. Wie werden Zellkulturen für die Kultur gewonnen?

Primärkultur:

Wenn Zellen chirurgisch aus einem Organismus entfernt und in eine geeignete Kulturumgebung gebracht werden, lagern sie sich an, teilen sich und wachsen. Dies wird als Primärkultur bezeichnet. Dafür gibt es zwei grundlegende Methoden.

Zuerst werden für Explantatkulturen kleine Gewebestücke an einem Glas befestigt oder in einem Plastikkulturgefäß behandelt und in Kulturmedium gebadet. Nach einigen Tagen wandern einzelne Zellen vom Gewebeexplantat auf die Oberfläche oder das Substrat des Kulturgefäßes, wo sie beginnen, sich zu teilen und zu wachsen.

Die zweite, weiter verbreitete Methode beschleunigt diesen Prozess, indem den Gewebefragmenten verdauliche (proteolytische) Enzyme wie Trypsin oder Collagenase zugesetzt werden, um den die Zellen zusammenhaltenden Zement aufzulösen. Dadurch entsteht eine Suspension einzelner Zellen, die dann in Kulturgefäße mit Kulturmedium gegeben werden und wachsen und sich teilen lassen. Diese Methode wird Enzymatische Dissoziation genannt.

Subkultivierung:

Wenn die Zellen im primären Kulturgefäß gewachsen sind und das gesamte verfügbare Kultursubstrat aufgefüllt haben, müssen sie subkultiviert werden, um ihnen Platz für weiteres Wachstum zu geben. Dies geschieht in der Regel, indem sie mit Enzymen möglichst schonend vom Substrat entfernt werden. Diese ähneln den Enzymen, die zum Erhalt der Primärkultur verwendet werden, und werden verwendet, um die Proteinbindungen zu brechen, die die Zellen an das Substrat binden.

Einige Zelllinien können geerntet werden, indem die Zellen vorsichtig vom Boden des Kulturgefäßes abgekratzt werden. Nach der Freisetzung kann die Zellsuspension dann unterteilt und in neue Kulturgefäße gefüllt werden. Sobald ein Überschuss an Zellen vorhanden ist, können diese mit geeigneten Kryoprotektiva wie Dimethylsulfoxid (DMSO) oder Glycerin behandelt, sorgfältig eingefroren und dann bei kryogenen Temperaturen (unter – 130°C) gelagert werden, bis sie benötigt werden.

Kaufen und Ausleihen:

Eine Alternative zur Etablierung von Kulturen durch Primärkultur besteht darin, etablierte Zellkulturen von Organisationen wie der American Type Culture Collection oder dem Coriell Institute for Medical Research zu kaufen. Diese beiden gemeinnützigen Organisationen bieten qualitativ hochwertige Zelllinien, die sorgfältig getestet werden, um die Authentizität der Zellen zu gewährleisten. Häufiger werden Forscher Zelllinien von anderen Labors (leihen) beziehen.

Obwohl diese Praxis weit verbreitet ist, hat sie einen großen Nachteil. Es besteht eine hohe Wahrscheinlichkeit, dass die auf diese Weise erhaltenen Zellen keine gesunden, brauchbaren Kulturen sind. Dies ist in der Regel auf vorherige Verwechslungen oder Kontaminationen mit anderen Zelllinien oder auf Kontaminationen mit Mikroorganismen wie Mykoplasmen, Bakterien, Pilzen oder Hefen zurückzuführen.

Sache Nr. 7. Eigenschaften kultivierter Zellen:

Sobald Zellen in Kultur sind, zeigen sie ein breites Spektrum an Verhaltensweisen, Eigenschaften und Formen.

Einige der gebräuchlicheren werden im Folgenden beschrieben:

Zellkultursysteme:

Für das Züchten von Zellen werden zwei grundlegende Kultursysteme verwendet. Diese basieren in erster Linie auf der Fähigkeit der Zellen, entweder an einem Glas- oder behandelten Kunststoffsubstrat befestigt zu wachsen (Monolayer Culture Systems) oder frei im Kulturmedium zu schwimmen (Suspension Culture Systems).

Monolayer-Kulturen werden normalerweise in mit Gewebekultur behandelten Schalen, T-Flaschen, Rollflaschen oder Platten mit mehreren Vertiefungen gezüchtet, wobei die Wahl auf der Anzahl der benötigten Zellen, der Art der Kulturumgebung, den Kosten und den persönlichen Vorlieben basiert.

Suspensionskulturen werden normalerweise entweder gezüchtet:

1. In magnetisch gedrehten Spinner-Kolben oder geschüttelten Erlenmeyer-Kolben, in denen die Zellen aktiv im Medium suspendiert gehalten werden.

2. In stationären Kulturgefäßen wie T-Flaschen und Flaschen, in denen die Zellen zwar nicht bewegt werden, sich aber nicht fest am Substrat anlagern können. Viele Zelllinien, insbesondere solche, die aus normalem Gewebe stammen, gelten als verankerungsabhängig, dh sie können nur wachsen, wenn sie an einem geeigneten Substrat befestigt sind.

Einige Zelllinien, die nicht mehr als normal angesehen werden (häufig als transformierte Zellen bezeichnet), sind häufig in der Lage, entweder an einem Substrat befestigt oder frei schwebend in Suspension zu wachsen, sie sind verankerungsunabhängig. Darüber hinaus heften sich einige normale Zellen, wie sie im Blut vorkommen, normalerweise nicht an Substrate und wachsen immer in Suspension.

Arten von Zellen:

Kultivierte Zellen werden normalerweise anhand ihrer Morphologie (Form und Aussehen) oder ihrer funktionellen Eigenschaften beschrieben.

Es gibt drei grundlegende Morphologien:

Zellen, die an einem Substrat befestigt sind und eine abgeflachte und polygonale Form aufweisen.

Zellen, die sich nicht normal an ein Substrat anheften, sondern mit einer kugelförmigen Form in Suspension bleiben.

Zellen, die an einem Substrat befestigt sind und länglich und bipolar erscheinen und in schweren Kulturen häufig Wirbel bilden. Es ist wichtig, sich daran zu erinnern, dass die Kulturbedingungen eine wichtige Rolle bei der Bestimmung der Form spielen und dass viele Zellkulturen mehrere Morphologien aufweisen können.

Unter Verwendung von Zellfusionstechniken ist es auch möglich, Hybridzellen zu erhalten, indem Zellen von zwei verschiedenen Eltern fusioniert werden. Diese können Merkmale eines Elternteils oder beider Elternteile aufweisen. Diese Technik wurde 1975 verwendet, um Zellen zu erzeugen, die in der Lage sind, maßgeschneiderte monoklonale Antikörper zu produzieren. Diese Hybridzellen (genannt Hybridomas) werden durch die Verschmelzung zweier verschiedener, aber verwandter Zellen gebildet. Der erste ist ein aus der Milz stammender Lymphozyt, der in der Lage ist, den gewünschten Antikörper zu produzieren.

Die zweite ist die sich schnell teilende Myelomzellmaschinerie zur Herstellung von Antikörpern, ist jedoch nicht darauf programmiert, Antikörper zu produzieren. Die resultierenden Hybridome können große Mengen des gewünschten Antikörpers produzieren. Diese Antikörper, die aufgrund ihrer Reinheit als monoklonale Antikörper bezeichnet werden, haben viele wichtige klinische, diagnostische und industrielle Anwendungen mit einem jährlichen Wert von weit über einer Milliarde Dollar.

Funktionale Eigenschaften:

Die Eigenschaften kultivierter Zellen ergeben sich sowohl aus ihrer Herkunft (Leber, Herz etc.) als auch aus ihrer Anpassungsfähigkeit an die Kulturbedingungen. Biochemische Marker können verwendet werden, um zu bestimmen, ob Zellen noch spezialisierte Funktionen ausführen, die sie in vivo ausgeführt haben (z. B. Leberzellen, die Albumin sezernieren). Auch morphologische oder ultrastrukturelle Marker können untersucht werden (z. B. schlagende Herzzellen).

Häufig gehen diese Eigenschaften durch die Platzierung in einer künstlichen Umgebung entweder verloren oder werden verändert. Einige Zelllinien hören schließlich auf, sich zu teilen und zeigen Alterserscheinungen. Diese Linien werden endlich genannt. Andere Linien sind oder werden unsterblich, diese können sich unbegrenzt weiter teilen und werden als kontinuierliche Zelllinien bezeichnet. Wenn eine “normale” endliche Zelllinie unsterblich wird, hat sie eine grundlegende irreversible Veränderung oder “Transformation” erfahren. Dies kann spontan geschehen oder absichtlich durch Medikamente, Strahlen oder Viren herbeigeführt werden.

Transformierte Zellen wachsen normalerweise leichter und schneller, können oft zusätzliche oder abnormale Chromosomen aufweisen und können häufig in Suspension gezüchtet werden. Zellen mit einer normalen Chromosomenzahl werden als diploide Zellen bezeichnet. Zellen mit einer anderen als der normalen Chromosomenzahl sind aneuploid. Bilden die Zellen bei der Injektion in Tiere Tumore, gelten sie als neoplastisch transformiert.

Sache # 8. Probleme mit kultivierten Zellen:

Kontamination vermeiden:

Es gibt zwei Hauptarten der Zellkulturkontamination: chemisch und biologisch. Chemische Verunreinigungen sind am schwierigsten zu erkennen, da sie durch unsichtbare Stoffe wie Endotoxine, Weichmacher, Metallionen oder Spuren chemischer Desinfektionsmittel verursacht werden.

Biologische Verunreinigungen in Form von schnell wachsenden Hefen, Bakterien und Pilzen haben in der Regel sichtbare Auswirkungen auf die Kultur (Änderungen der Mediumtrübung oder des pH-Wertes) und sind somit leichter zu erkennen (insbesondere wenn Antibiotika im Kulturmedium weggelassen werden). Zwei andere Formen biologischer Kontamination, Mykoplasmen und Viren, sind jedoch visuell nicht leicht zu erkennen und erfordern in der Regel spezielle Nachweisverfahren.

Es gibt zwei Hauptanforderungen, um eine Kontamination zu vermeiden. Erstens eine angemessene Schulung in der Anwendung einer guten aseptischen Technik seitens des Zellzüchters. Zweitens, richtig entworfene, gewartete und sterilisierte Ausrüstung, Plastikwaren, Glaswaren und Medien. Der sorgfältige und selektive (begrenzte) Einsatz von Antibiotika, die für die Verwendung in der Gewebekultur entwickelt wurden, kann auch dazu beitragen, Kulturverluste aufgrund biologischer Kontamination zu vermeiden.

Eine “glückliche” Umgebung finden:

Für Zellzüchter ist eine “glückliche” Umgebung eine Umgebung, die mehr bewirkt als nur das Überleben von Zellen in Kultur. Normalerweise bedeutet es eine Umgebung, die es zumindest ermöglicht, die Zahl der Zellen durch Zellteilung (Mitose) zu erhöhen. Noch besser, wenn die Bedingungen genau richtig sind, drücken einige kultivierte Zellen ihr “Glück” mit ihrer Umgebung aus, indem sie in vivo wichtige physiologische oder biochemische Funktionen wie Muskelkontraktion oder die Sekretion von Hormonen und Enzymen ausführen. Um diese Umgebung bereitzustellen, ist es wichtig, den Zellen die geeignete Temperatur, ein gutes Substrat zum Anhaften und das richtige Kulturmedium bereitzustellen.

Die Temperatur wird normalerweise auf den gleichen Punkt eingestellt wie die Körpertemperatur des Wirts, von dem die Zellen erhalten wurden. Bei kaltblütigen Wirbeltieren ist ein Temperaturbereich von 18-25°C geeignet, die meisten Säugerzellen benötigen 36-37°C. Dieser Temperaturbereich wird normalerweise durch sorgfältig kalibrierte und häufig überprüfte Inkubatoren aufrechterhalten. Verankerungsabhängige Zellen benötigen auch ein gutes Substrat für die Anheftung und das Wachstum.

Glas und speziell behandelte Kunststoffe (um die normalerweise hydrophobe Kunststoffoberfläche hydrophil oder benetzbar zu machen) sind die am häufigsten verwendeten Substrate. Anheftungsfaktoren wie Kollagen, Gelatine, Fibronektin und Laminin können jedoch als Substratbeschichtungen verwendet werden, um das Wachstum und die Funktion normaler Zellen aus Gehirn, Blutgefäßen, Nieren, Leber, Haut usw. zu verbessern. Oft normale verankerungsabhängige Zellen funktionieren auch besser, wenn sie auf einer durchlässigen oder porösen Oberfläche gezüchtet werden.

Dies ermöglicht es ihnen, zu polarisieren (oben und unten, durch die Dinge in die Zelle ein- und austreten können), wie sie es im Körper tun. Trans-Well-Inserts sind Corning-Gefässe mit membranbasierten durchlässigen Trägern, die es diesen Zellen ermöglichen, Polarität zu entwickeln und die Fähigkeit zu erwerben, spezielle Funktionen wie den Transport zu erfüllen. Viele spezialisierte Zellen können nur dann wirklich “happy” (normale Funktion) sein, wenn sie auf einem porösen Substrat in serumfreiem Medium mit der entsprechenden Mischung aus Wachstums- und Bindungsfaktoren gezüchtet werden.

Zellen können auch in Suspension auf Kügelchen aus Glas, Kunststoff, Polyacrylamid und vernetzten Dextranmolekülen gezüchtet werden. Diese Technik wurde verwendet, um die Züchtung von verankerungsabhängigen Zellen in Suspensionskultursystemen zu ermöglichen und wird für die Herstellung von zellbasierten biologischen Produkten immer wichtiger. Das Kulturmedium ist der wichtigste und komplexeste Faktor, der kontrolliert werden muss, um Zellen “happy” zu machen.

Neben der Deckung des Grundbedarfs an Nährstoffen der Zellen sollte das Kulturmedium auch notwendige Wachstumsfaktoren aufweisen, den pH-Wert und die Osmolalität regulieren und essentielle Gase (O2 und CO2). Der Anteil ‘food’ des Kulturmediums besteht aus Aminosäuren, Vitaminen, Mineralstoffen und Kohlenhydraten. Diese ermöglichen es den Zellen, neue Proteine ​​und andere für Wachstum und Funktion essentielle Komponenten aufzubauen und die für den Stoffwechsel notwendige Energie bereitzustellen.

Die Wachstumsfaktoren und Hormone helfen, die Wachstumsrate und die funktionellen Eigenschaften der Zellen zu regulieren und zu kontrollieren. Anstatt direkt dem Medium zuzugeben, werden sie oft in undefinierter Weise durch Zugabe von 5 bis 20 % verschiedener Tierseren zum Medium zugegeben. Leider variieren die Arten und Konzentrationen dieser Faktoren im Serum beträchtlich von Charge zu Charge. Dies führt oft zu Problemen bei der Kontrolle von Wachstum und Funktion. Beim Züchten normaler funktioneller Zellen werden Seren oft durch spezifische Wachstumsfaktoren ersetzt.

Das Medium kontrolliert auch den pH-Bereich der Kultur und puffert die Zellen vor abrupten pH-Änderungen. Normalerweise ein CO2- Puffer auf Bicarbonatbasis oder ein organischer Puffer wie HEPES wird verwendet, um den pH-Wert des Mediums in einem Bereich von 7,0 bis 7,4 zu halten, abhängig vom Zelltyp, der kultiviert wird. Bei Verwendung eines CO2-Bicarbonatpuffer, es ist notwendig, die CO .-Menge zu regulieren2 im Medium gelöst.

Dies geschieht normalerweise mit einem Inkubator mit CO2 Regler eingestellt, um eine Atmosphäre mit zwischen 2 % und 10 % CO . bereitzustellen2 (für Earle’s-Puffer auf Salzbasis). Einige Medien verwenden jedoch ein CO2– Bicarbonat-Puffer (für Hanks’-Puffer auf Salzbasis), der kein zusätzliches CO . benötigt2, aber es muss in einem verschlossenen Gefäß verwendet werden (kein Geschirr oder Teller).

Schließlich ist die Osmolalität (osmotischer Druck) des Kulturmediums wichtig, da sie hilft, den Stofffluss in und aus der Zelle zu regulieren. Sie wird durch die Zugabe oder Subtraktion von Salz im Kulturmedium kontrolliert. Die Verdunstung von Kulturmedien aus offenen Kulturgefäßen (Schalen usw.) erhöht die Osmolalität schnell, was zu gestressten, beschädigten oder toten Zellen führt. Für offene (nicht versiegelte) Kultursysteme sind Inkubatoren mit hoher Luftfeuchtigkeit zur Reduzierung der Verdunstung unerlässlich.

Sache Nr. 9. So entscheiden Sie, ob kultivierte Zellen „glücklich“ sind

Die Bewertung der allgemeinen Gesundheit oder des „Glücks“ einer Kultur basiert normalerweise auf vier wichtigen Zellmerkmalen: Morphologie, Wachstumsrate, Plattierungseffizienz und Expression spezieller Funktionen. Dieselben Eigenschaften werden auch häufig bei der Bewertung experimenteller Ergebnisse verwendet.

Die Morphologie oder Zellform ist am einfachsten zu bestimmen, aber oft am wenigsten nützlich. Während in Kulturen häufig Veränderungen der Morphologie beobachtet werden, ist es oft schwierig, diese Beobachtungen mit dem Zustand in Verbindung zu bringen, der sie verursacht hat. Es ist auch ein sehr schwieriges Merkmal, das zu quantifizieren oder genau zu messen ist.

Das erste Anzeichen dafür, dass mit einer Kultur etwas nicht stimmt, tritt oft auf, wenn die Zellen mikroskopisch untersucht werden und schlechte oder ungewöhnliche Muster der Zellanhaftung oder des Zellwachstums beobachtet werden. Bei Verdacht auf Probleme kann die Färbung der Kulturgefäße mit Kristallviolett oder anderen einfachen histologischen Färbungen Wachstumsmuster zeigen, die auf ein Problem hinweisen.

Zellzählen und andere Methoden zur Schätzung der Zellzahl ermöglichen andererseits die Bestimmung der Wachstumsrate, die gegenüber größeren Veränderungen in der Kulturumgebung empfindlich ist. Dies ermöglicht das Design von Experimenten, um zu bestimmen, welche Bedingungen (Kulturmedien, Substrat, Serum, Plastikgeschirr) für die Zellen besser sind, d. h. die Bedingungen, die die beste Wachstumsrate erzeugen.

Diese gleichen oder ähnliche Techniken können auch verwendet werden, um das Überleben oder den Tod von Zellen zu messen, und werden oft für in vitro-Zytotoxizitätsassays verwendet. Die Beschichtungseffizienz ist eine Testmethode, bei der eine kleine Anzahl von Zellen (20 bis 200) in ein Kulturgefäß gegeben und die Anzahl der von ihnen gebildeten Kolonien gemessen wird.

Der Prozentsatz der Kolonien bildenden Zellen ist ein Maß für das Überleben, während die Koloniegröße ein Maß für die Wachstumsrate ist. Dieses Testverfahren ist in der Anwendung der Wachstumsratenanalyse ähnlich, reagiert jedoch empfindlicher auf kleine Variationen der Kulturbedingungen. Das letzte Merkmal, der Ausdruck spezialisierter Funktionen, ist normalerweise am schwierigsten zu beobachten und zu messen.

Üblicherweise werden biochemische oder immunologische Assays und Tests verwendet. Während kultivierte Zellen unter suboptimalen Bedingungen sehr gut wachsen können, erfordern hochspezialisierte Funktionen normalerweise nahezu perfekte Kulturbedingungen und gehen oft schnell verloren, wenn Zellen in Kultur gebracht werden.



Bemerkungen:

  1. Alborz

    Ist komplett umsonst.

  2. Averell

    Geld ist niemals so gut wie schlecht ohne es. Nützliche Haushaltstipps: Der Müll kann herausgenommen werden, wenn der Geruch unerträglich ist. Um zu verhindern, dass die Milch entkommt, binden Sie die Kuh fest. Schuhe dauern viel länger, wenn Sie keinen neuen kaufen. Ein kochender Wasserkocher wird lauter pfeifen, wenn Sie jemanden aus Ihrer Familie darauf legen ... wenn ich nicht ausflippen werde, werde ich ihn streuen. Wenn Sie in den Spiegel geschaut haben, aber dort niemanden gefunden haben, sind Sie unwiderstehlich! Wie lange ich lebe, kann ich zwei Dinge nicht verstehen: Woher kommt der Staub und wohin geht das Geld?

  3. Juhn

    Ich bin der Meinung, dass Sie nicht Recht haben. Ich bin versichert. Ich schlage vor, darüber zu diskutieren.



Eine Nachricht schreiben