Information

Was ist der Unterschied zwischen einem DPY-10, DPY-11 und DPY-13?

Was ist der Unterschied zwischen einem DPY-10, DPY-11 und DPY-13?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mein TA erwähnte diese drei Mutationen von C. elegans, seit wir angefangen haben, mit den Würmern zu arbeiten, scheint aber die Unterschiede zu überspringen…


Dpy ist eine Klasse von Genen. Normalerweise werden sie in Kleinbuchstaben geschrieben, wenn sie sich auf ein mutiertes Allel beziehen. Der Name Dpy selbst steht für Dumpy und leitet sich von der morphologischen Veränderung ab, die auftritt, wenn eines oder mehrere der Gene mutiert werden: Die Würmer erscheinen klein und fett oder Dumpig.

Eine weitere große Klasse ist Unc. Mutationen in diesen Genen verursachen unkoordinierte Bewegungen.

Eine Beschreibung der Gene finden Sie unter http://www.wormbase.org


Prolyl-4-hydroxylase wird für die Lebensfähigkeit und Morphogenese benötigt Caenorhabditis elegans

Das Genom von Caenorhabditis elegans besitzt zwei Gene, dpy-18 und phy-2, die für α-Untereinheiten des Enzyms Prolyl-4-hydroxylase kodieren. Wir haben Deletionen innerhalb jedes Gens erzeugt, um die Prolyl-4-hydroxylase-Aktivität aus dem Tier zu eliminieren. Die dpy-18 Die Mutante weist eine abweichende Körpermorphologie auf, die mit einer Rolle der Prolyl-4-hydroxylase bei der Bildung der Körperkutikula übereinstimmt. Die phy-2 Mutante ist phänotypisch Wildtyp. Allerdings ist die dpy-18 phy-2 Doppelmutante ist nicht lebensfähig, was auf eine essentielle Rolle der Prolyl-4-Hydroxylase hindeutet, die normalerweise von entweder dpy-18 oder phy-2. Die Auswirkungen der Doppelmutation wurden durch niedermolekulare Inhibitoren der Prolyl-4-Hydroxylase nachgeahmt, was die genetischen Ergebnisse bestätigt und darauf hindeutet, dass C. elegans kann als Modellsystem für die Entdeckung neuer Inhibitoren dienen.

Kollagen ist das am häufigsten vorkommende Protein bei Tieren. Jede Polypeptidkette von Kollagen besteht aus Wiederholungen der Sequenz: X-Y-Gly, wobei X oft ein l-Prolinrest ist und Y oft ein 4(R)-Hydroxy-l-prolin (Hyp)-Rest. Diese Ketten sind zu engen Dreifach-Helices gewunden, die in Fibrillen von großer Zugfestigkeit organisiert sind. Die Hydroxylgruppen der Hyp-Reste tragen stark zur Konformationsstabilität von Tripelhelix-Kollagen (1–3) bei. Hyp-Reste werden von Ribosomen nicht in Kollagen eingebaut. Vielmehr wird die Hydroxylierung von Pro-Resten in Kollagensträngen durch das Enzym Prolyl-4-hydroxylase (EC 1.14.11.2) katalysiert. Prolyl-4-hydroxylase wurde am besten bei Wirbeltieren einschließlich des Menschen charakterisiert (4–7). Das Wirbeltierenzym ist ein Tetramer, das aus zwei α-Untereinheiten und zwei β-Untereinheiten besteht. Die α-Untereinheit bindet ein zweiwertiges Fe 2+ -Kation, α-Ketoglutarat und Ascorbat, und besitzt das aktive Zentrum für die Hydroxylierung. Die β-Untereinheit ist nicht nur ein wesentlicher Bestandteil der tetrameren Prolyl-4-hydroxylase, sondern besitzt auch eine eigene enzymatische Aktivität als Proteindisulfid-Isomerase (EC 5.3.4.1), ein Enzym, das die Entschlüsselung nichtnativer Disulfidbrücken (8–10 .) katalysiert ). Ein Mangel an Prolyl-4-hydroxylase-Aktivität wird bei Tieren beobachtet, denen Vitamin C in der Nahrung fehlt, und hat schwerwiegende Folgen, was zu dem als Skorbut bekannten Krankheitszustand führt (11).

Wir haben begonnen, die biologische Rolle der Prolyl-4-hydroxylase in zu untersuchen Caenorhabditis elegans. Dieser kleine Nematode bietet mehrere wichtige experimentelle Vorteile für in vivo Studien: ausgeklügelte Vorwärts- und Rückwärtsgenetik (12, 13), eine einfache Körpermorphologie, die auf der Ebene einzelner Zellen analysiert werden kann (14) und eine nahezu vollständige Genomsequenz (15). Kollagen ist ein Hauptbestandteil von C. elegans, umfassend etwa 1 % des Gewichts eines erwachsenen Nematoden (16). Die meisten C. elegans Kollagen befindet sich in der Kutikula und in der Basalmembran (17).

Eine Prolyl-4-Hydroxylase-α-Untereinheit und zwei potenzielle β-Untereinheiten wurden in der identifiziert C. elegans Genom und biochemisch charakterisiert (18, 19). Die C. elegans α- und β-Untereinheiten sind beide zu ihren Vertebraten-Gegenstücken homolog. Im Gegensatz zum tetrameren Wirbeltierenzym ist die C. elegans α-Untereinheit bildete ein αβ-Dimer mit entweder dem C. elegans β-Untereinheit oder die menschliche β-Untereinheit (Proteindisulfidisomerase). Wie die Vertebraten-Prolyl-4-Hydroxylase ist die C. elegans Enzym interagierte mit dem zweiwertigen Kation von Fe 2+, α-Ketoglutarat und Ascorbat, den Prolyl-4-Hydroxylase-Cofaktoren, und es besaß auch Prolyl-4-Hydroxylase-Aktivität (18, 19).

Hier berichten wir, dass die C. elegans Genom besitzt zwei Gene, die α-Untereinheiten der Prolyl-4-Hydroxylase kodieren. Wir haben für jedes Gen eine Deletionsmutante erzeugt und ihre biologischen Rollen untersucht. Ein Gen, dpy-18, ist essentiell für die Wildtyp-Körpermorphologie der andere, phy-2, wird benötigt für dpy-18 Lebensfähigkeit der Mutanten und umgekehrt. Wir haben auch gezeigt, dass bekannte niedermolekulare Inhibitoren der Prolyl-4-Hydroxylase den Verlust von . nachahmen können dpy-18 und phy-2 Gen-Aktivitäten.


Abstrakt

Die Verhaltensphänotypisierung von Modellorganismen wird häufig verwendet, um grundlegende Aspekte der Organismusbiologie zu untersuchen, von der Funktion des Nervensystems bis hin zu den Auswirkungen genetischer Mutationen, sowie zum Screening neuer Wirkstoffe. Unsere Fähigkeit, die gesamte Bandbreite und Komplexität von Verhaltensreaktionen zu beobachten und zu quantifizieren, wird jedoch durch die Unfähigkeit konventioneller Mikroskopietechniken begrenzt, volumetrische Bildinformationen mit ausreichender Geschwindigkeit zu erfassen. In diesem Artikel beschreiben wir, wie die Kombination von Lichtfeldmikroskopie mit computergestützter Tiefenschätzung eine neue Methode zur schnellen, quantitativen Bewertung der 3D-Haltung und -Bewegung des Modellorganismus Caenorhabditis elegans (C. elegans). Wir wenden diese Technik an, um das Verhalten von Cuticula-Kollagenmutanten zu vergleichen und signifikante Unterschiede in der 3D-Haltung und Fortbewegung zu finden. Wir demonstrieren die Fähigkeit der quantitativen Lichtfeldmikroskopie, neue grundlegende Erkenntnisse über C. elegans Fortbewegung durch Analyse der 3D-Haltungsmodi eines frei schwimmenden Wurms. Schließlich betrachten wir die relativen Vorzüge der Methode und ihre breitere Anwendung für die phänotypische Bildgebung anderer Organismen und für andere volumetrische Biobildgebungsanwendungen.

Zitat: Shaw M, Zhan H, Elmi M, Pawar V, Essmann C, Srinivasan MA (2018) Dreidimensionale Verhaltensphänotypisierung von freier Bewegung C. elegans mit quantitativer Lichtfeldmikroskopie. PLoS ONE 13(7): e0200108. https://doi.org/10.1371/journal.pone.0200108

Editor: Giorgio F. Gilestro, Imperial College London, VEREINIGTES KÖNIGREICH

Empfangen: 17. Januar 2018 Akzeptiert: 19. Juni 2018 Veröffentlicht: 11. Juli 2018

Urheberrechte ©: © 2018 Shaw et al. Dies ist ein Open-Access-Artikel, der unter den Bedingungen der Creative Commons Attribution License vertrieben wird und die uneingeschränkte Verwendung, Verbreitung und Reproduktion in jedem Medium gestattet, sofern der ursprüngliche Autor und die Quelle angegeben werden.

Datenverfügbarkeit: Die dieser Studie zugrunde liegenden Daten wurden auf figshare hochgeladen und sind über den folgenden DOI zugänglich: 10.6084/m9.figshare.6670805.

Finanzierung: Diese Arbeit wurde durch einen Advanced Grant 247401 an MAS des Europäischen Forschungsrats (ERC-2009-AdG, MicroNanoTeleHaptics) und einen Capital Grant for Great Technologies Grant (EP/K005030/1 an MAS) der britischen Ingenieur- und Physikalischen Wissenschaften finanziert Forschungsrat. Die Geldgeber spielten keine Rolle beim Studiendesign, der Datenerhebung und -analyse, der Entscheidung zur Veröffentlichung oder der Erstellung des Manuskripts.

Konkurrierende Interessen: Die Autoren haben erklärt, dass keine konkurrierenden Interessen bestehen.


MATERIALEN UND METHODEN

Alle C. elegans Mutantenstämme wurden vom Wildtyp-Stamm N2 Bristol abgeleitet und enthielten eines oder mehrere der folgenden Allele: rol-6(su1006) II, lin-8(n111) II, lin-9(n112) III, spe-48(hc85) I (früher identifiziert als spe-8), spe-10(hc104) V, dpy-11(e224) V, unc-76(e911) V. Das hawaiianische Stammisolat CB4856 (Hodgkin &. Doniach, 1997) wurde für die Polymorphismuskartierung verwendet. CRISPR-vermittelte Genbearbeitung zum Erstellen von spe-48 (gd11) wurde wie zuvor beschrieben durchgeführt (Paix et al., 2015), mit dpy-10 als Co-CRISPR-Marker (Arribere et al., 2014). CRISPR-Reagenzien sind in Ergänzungstabelle S1 aufgeführt. Würmer wurden unter Verwendung von Standardwachstumsbedingungen vermehrt (Brenner, 1974). Fertilitätstests wurden wie zuvor beschrieben durchgeführt (Kulkarni et al., 2012).

Sequenzierungsbibliotheken wurden mit dem TruSeq DNA Sample Prep Kit v2 für Proben mit großem Input oder TruSeq ChIP Sample Prep Kit für Proben mit geringem Input (Illumina, San Diego, CA) erstellt. Kurz gesagt wurden gDNA-Proben durch Beschallung geschert, an den Enden repariert, A-Schwanz, Adapter-ligiert und PCR-amplifiziert. Ein detailliertes Protokoll zur Gewinnung von gescherter gDNA aus Proben mit geringem Input finden Sie in der Ergänzung (Datei S1). Bibliotheken wurden auf einem HiSeq 2500 (Illumina, San Diego, CA) sequenziert, um 50bp-Reads zu erzeugen und ergaben eine >20-fache Genomabdeckung pro Probe. Als Referenz wurde die Genomversion WS220 (www.wormbase.org) verwendet. Die SNP-Daten in Abbildung 1 wurden mit einer BFAST-Pipeline (Homer et al., 2009) für Alignment und SAMtools (Li et al., 2009) für Variantenaufrufe. Alle anderen SNP-Daten wurden mit BBMap (Bushnell, 2015) für das Alignment und FreeBayes (Garrison und Marth, 2012) für das Varianten-Calling erhalten. Doppelte Lesevorgänge wurden nach dem Alignment entfernt und, sofern nicht anders angegeben, waren für einen Variantenaufruf mindestens drei unabhängige Lesevorgänge erforderlich. ANOVAR (Wang et al., 2010) wurde für die Annotation verwendet. Für die Polymorphismus-Kartierung wurden die SNP-Frequenzen mit LOESS-Regressionen gegen die Chromosomenposition mit R (R Core Team, 2015) aufgetragen, wobei die gleichen Parameter verwendet wurden, die für CloudMap (Minevich et al., 2012). Sequenzdaten sind im NCBI Sequence Read Archive (BioProject-Zugangsnummer PRJNA305991) verfügbar.


Die Anwendung von CRISPR-Cas9 Genome Editing bei Caenorhabditis elegans

Dokumente empfehlen

Akzeptiertes Manuskript Die Anwendung von CRISPR-Cas9 Genome Editing bei Caenorhabditis elegans Suhong Xu PII:

Zeitschrift für Genetik und Genomik

Eingangsdatum: 11. Mai 2015 Überarbeitetes Datum:

Angenommenes Datum: 19. Juni 2015

Bitte zitieren Sie diesen Artikel als: Xu, S., The application of CRISPR-Cas9 Genome Editing in Caenorhabditis elegans, Journal of Genetics and Genomics (2015), doi: 10.1016/j.jgg.2015.06.005. Dies ist eine PDF-Datei eines unbearbeiteten Manuskripts, das zur Veröffentlichung angenommen wurde. Als Service für unsere Kunden stellen wir diese frühe Version des Manuskripts zur Verfügung. Das Manuskript wird Lektorat, Satz und Überprüfung des resultierenden Korrekturabzuges unterzogen, bevor es in seiner endgültigen Form veröffentlicht wird. Bitte beachten Sie, dass während des Produktionsprozesses Fehler entdeckt werden können, die sich auf den Inhalt auswirken können, sowie alle rechtlichen Hinweise, die für die Zeitschrift gelten.

Die Anwendung von CRISPR-Cas9 Genome Editing bei Caenorhabditis elegans

Abteilung für biologische Wissenschaften, Abteilung für Zell- und Entwicklungsbiologie, University of California,

San Diego, 9500 Gilman Drive, La Jolla, CA 92093

Die Korrespondenz ist zu richten an: [email protected]

Die Genom-Editierung mit der Cas9-Endonuklease von Streptococcus pyogenes hat sich als beispiellos erwiesen

Wirksamkeit und Möglichkeit zur Modifikation von Genomen in einer Vielzahl von Organismen. Caenorhabditis elegans ist

einer der bequemsten vielzelligen Organismen für die genetische Analyse und Anwendung dieses Romans

Genome Editing-Technik für diesen Organismus verspricht, die Analyse der Genfunktion in der

Zukunft. CRISPR-Cas9 wurde erfolgreich verwendet, um ungenaue Insertionen und Deletionen über nicht-

homologe Endverbindungsmechanismen und zur Erzeugung präziser Mutationen durch homologiegerichtete Reparatur von

Spendervorlagen. Schlüsselvariablen sind die Methoden, mit denen die Cas9-Endonuklease abgegeben wird, und die

Effizienz der einzelnen Leit-RNAs. Die CRISPR-Cas9-vermittelte Bearbeitung scheint bei C.

elegans, ohne berichtete Off-Target-Effekte. Diese Übersicht fasst die jüngsten Fortschritte bei CRISPR-

Cas9-basierte Genom-Editierung in C. elegans, die technische Verbesserungen in der Mutagenese hervorhebt und

Mutationsdetektion und Diskussion möglicher zukünftiger Anwendungen dieser Technik.

Schlüsselwörter: Genome Editing, CRISPR, Cas9, Non-homologes End-Joining (NHEJ), homology-directed

Reparatur (HDR), somatische Mutation, C. elegans

Jüngste Durchbrüche bei Genome-Editing-Technologien, die eine präzise Modifikation des Doppel-

gestrandete DNA eines Organismus verspricht ungeahnte Möglichkeiten zur Identifizierung und

Charakterisierung von Genfunktionen in biologischen Prozessen. Diese wertvollen Technologien beruhen auf der Erkenntnis

dass eukaryotische Zellen über endogene Mechanismen zur Reparatur von DNA-Doppelstrangbrüchen (DSBs) verfügen (Carroll,

2011). Die anvisierten DSBs können entweder über das fehleranfällige nicht homologe End-Joining (NHEJ) repariert werden

Reparaturweg, der kleine Insertions- oder Deletionsmutationen (Indels) induziert, die zu einem Frame führen können

Verschiebung in einer kodierenden Region oder über den Homology-Directed Repair (HDR)-Weg, der spezifische

Punktmutationen oder Insertion/Deletion einer gewünschten Sequenz durch homologe Rekombination mit

exogen bereitgestellte DNA-Matrizen. Neuere Genome Editing-Methoden verwenden auch programmierbare Nukleasen

Genunterbrechung, Insertion oder Substitution von genomischen Sequenzen auf kontrollierte Weise einzuführen

(Segal und Meckler, 2013 Maggio und Goncalves, 2015). Mehrere maßgeschneiderte Endonukleasen wurden

in der Genom-Editierung im letzten Jahrzehnt verwendet, wie Meganukleasen, Zink-Finger-Nukleasen (ZFNs) und

Transkriptionsaktivator-ähnliche Effektornukleasen (TALENs) (Hsu et al., 2014 Maggio und Goncalves, 2015).

Sie ermöglichen spezifische Genommanipulationen durch Protein-DNA-Interaktion zum Targeting. Alle

Diese Ansätze haben wertvolle Informationen zur Genom-Editierung geliefert, jedoch hat jeder seine eigenen Besonderheiten

Schwächen, die ihre breitere Anwendung eingeschränkt haben.

Der neueste und sich am schnellsten entwickelnde Ansatz in der Genom-Editierung ist das CRISPR (regelmäßig geclustert)

interspaced short palindromic repeats)-assoziierte Protein-9-Endonuklease (im Folgenden als Cas9 bezeichnet),

abgeleitet von bakteriellen adaptiven Immunsystemen (Doudna und Charpentier, 2014). Das CRISPR-Cas9

System kann verwendet werden, um praktisch jeden genomischen Locus durch eine Leit-RNA anzuvisieren, die das Ziel erkennt

DNA über Watson-Crick-Basenpaarung. Das Typ-II-CRISPR-Cas9-System aus Streptococcus pyogenes ist

ist die einfachste und am weitesten verbreitete und führt nachweislich ortsspezifische DSBs ein, die

anschließend entweder durch NHEJ oder HDR repariert (Doudna und Charpentier, 2014). Die Kernkomponenten von

das CRISPR-Cas9-System sind eine Endonuklease Cas9 mit zwei katalytischen Nukleasedomänen (RuvC

und HNH) und eine Single-Guide-RNA (sgRNA)-Chimäre, die die Funktionen der CRISPR-RNA kombiniert

(crRNA) und transaktivierende crRNA (tracrRNA) (Jinek et al., 2012). Die spezifische Reihenfolgeanforderung

für das chromosomale Editieren hängt von der 20 nt-Sequenz am 5′-Ende der sgRNA ab, die

gefolgt von einem Protospacer-Advantage-Motiv (PAM) von NGG in der DNA, um eine effiziente Spaltung zu ermöglichen (Abb.

1). Somit ist die CRISPR-Cas9-vermittelte Genom-Editierung programmierbar und kann leicht auf die meisten ausgerichtet werden

Genomorte der Wahl durch das Design der sgRNA. Im Vergleich zu anderen proteingesteuerten

Gegenstücke, ZFNs und TALENs, bietet dieses RNA-gesteuerte Genom-Editing-Tool mehrere entscheidende Vorteile,

wie Einfachheit, Zugänglichkeit, Erschwinglichkeit und Multiplexing (Cong et al., 2013 Hsu et al., 2014).

Seit der wegweisenden Demonstration der CRISPR-Cas9-Genombearbeitung im Jahr 2012 (Jinek et al., 2012)

System hat die funktionelle Genomik in vielen Modellorganismen revolutioniert (Bassett et al., 2013 Belhaj et

al., 2013 Chang et al., 2013 Chen et al., 2013b Cong et al., 2013 DiCarlo et al., 2013 Friedland et al.,

2013 Gratz et al., 2013 Hwang et al., 2013 Li et al., 2013 Mali et al., 2013b Wang et al., 2013b Wei et al

al., 2013 Yu et al., 2013 Bassett und Liu, 2014 Ma et al., 2014).

Der Nematode Caenorhabditis elegans ist ein weit verbreiteter genetischer Modellorganismus, bei dem vorwärts und

Umkehrgenetische Ansätze sind gut entwickelt. CRISPR-Cas9-basierte Genom-Editierung wurde

erfolgreich auf C. elegans angewendet und wurde kürzlich überprüft (Frokjaer-Jensen, 2013 Waaijers and

Boxem, 2014). Hier fasse ich die rasante Entwicklung und jüngste Verfeinerung des CRISPR-Cas9 . zusammen

als Plattform für den Erhalt benutzerdefinierter Genommodifikationen. Ich bespreche die jüngsten Verbesserungen in

CRISPR-Cas9-Methodik und ihre Anwendungen bei C. elegans.

DIE ENTWICKLUNG VON CRISPR-CAS9 IN C. ELEGANS

Obwohl zufällig induzierte Deletionsmutationen leicht erzeugt und durch PCR-basierte . nachgewiesen werden können

Screening (Gengyo-Ando und Mitani, 2000 Edgley et al., 2002 Barstead und Moerman, 2006), C.

elegans fehlt seit langem ein effizientes homologiebasiertes reverses genetisches System. Frühe Ansätze verließen sich auf

die Verwendung von Transposon-Insertionen (endogene Tc-Transposons oder exogenes Mos1), um ortsspezifische

DSBs (Plasterk und Groenen, 1992 Robert und Bessereau, 2007 Frokjaer-Jensen et al., 2008 Frokjaer-

Jensen et al., 2010 Frokjaer-Jensen et al., 2012). Die Transposase kann gewünschte löschen oder einfügen

Sequenz an der Insertionsstelle durch HDR. Diese Methode ist robust und ermöglicht eine präzise Genom-Editierung,

wird jedoch durch die relative Seltenheit des Editierereignisses und die Notwendigkeit einer Transposon-Insertionsstelle eingeschränkt

(Frokjaer-Jensen et al., 2008 Frokjaer-Jensen et al., 2010).

In jüngerer Zeit wurde auch gezeigt, dass Nuklease-basierte Genome Editing-Ansätze (ZFNs und TALENs)

Arbeit in C. elegans (Wood et al., 2011 Cheng et al., 2013 Lo et al., 2013). Obwohl solche Ansätze

in bestimmten Situationen dennoch nützlich sein kann, kann man mit Recht sagen, dass die Effizienz und Einfachheit des CRISPR-

Die Cas9-Methode hat die C. elegans-Gemeinschaft im Sturm erobert, was zu einer Explosion der Forschung über ihre

Anwendung und Optimierung.

Für die CRISPR-Cas9-vermittelte Genom-Editierung ist die Expression des Cas9-Proteins und

sgRNA im Zellkern, wo der Cas9-sgRNA-DNA-Komplex aufgebaut wird. Keimbahnausdruck von

Cas9 und sgRNA werden benötigt, um erbliche Veränderungen zu erzeugen, während die somatische Gewebeexpression erzeugen kann

nicht vererbbare somatische Mutationen. Mehrere Implementierungen von CRISPR-Cas9 wurden in C.

elegans, jeweils mit Vor- und Nachteilen (Waaijers und Boxem, 2014). Ein wichtiger Unterschied

wird Cas9 und sgRNA zum Keimbahnkern transportiert (Abb. 1). Cas9 kann geliefert werden von

Mikroinjektion von in vitro transkribierter mRNA (Chiu et al., 2013 Katic und Grosshans, 2013), reines Protein

(Cho et al., 2013) oder Plasmid-DNA (Chen et al., 2013b Dickinson et al., 2013 Friedland et al., 2013 Lo

et al., 2013 Tzur et al., 2013). In ähnlicher Weise kann die sgRNA auch durch in vitro-Transkription eingeführt werden

(Chiu et al., 2013 Cho et al., 2013 Katic und Grosshans, 2013) oder in der Keimbahn exprimiert mit an

RNA-Polymerase III-Promotor wie U6 (Chen et al., 2013b Dickinson et al., 2013 Friedland et al.,

2013 Tzur et al., 2013) (Tabelle 1). Interessanterweise ist die Bakterienfütterung, die genspezifische Doppel-

Stranded RNAs (dsRNAs), können auch Leit-RNAs in Cas9-exprimierende Würmer einführen, um Gen . zu erreichen

Störung (Liu et al., 2014). Diese Grundlagenstudien ebnen den Weg für eine breite Umsetzung von

CRISPR-Cas9-Technologie als Werkzeug zur Genom-Editierung bei C. elegans. Trotz der Unterschiede in der Lieferung, alle

der oben genannten Ansätze waren erfolgreich bei der Generierung von Mutationen. Wegen der Leichtigkeit

Plasmidklonierung im Vergleich zur Protein- oder RNA-Aufreinigung, auf die derzeit die gängigsten Methoden angewiesen sind

Mikroinjektion von Plasmiden, die das Cas9-Protein und sgRNAs exprimieren, in die Keimbahn, gefolgt von

Phänotyp-basiertes oder PCR-basiertes Screening von Nachkommen.

Erfolgreiche Expression von Cas9-Protein und sgRNA im Zellkern erzeugt normalerweise stumpfe DSBs 3

Basenpaare stromaufwärts der PAM-Sequenz im Chromosom. Cas9 spaltet DNA mit zwei katalytischen

Domänen: eine HNH-Nukleasedomäne, die den zur sgRNA komplementären Strang spaltet, und eine RuvC

Nukleasedomäne, die den nicht-komplementären Strang spaltet (Fig. 1). Es wurde gezeigt, dass beide Spaltungen

induzieren eine fehleranfällige NHEJ-Genomzerstörung und HDR-basierte präzise Genommodifikation in C. elegans.

Unpräzise Genom-Editierung durch Non-Homologous End-Joining

Cas9-Nuklease-induzierte DNA-DSBs können durch NHEJ repariert werden, was zur effizienten Erzeugung von

kleine Insertionen oder Deletionen (Indels), die somit den Leserahmen oder die regulatorische Region stören können

Generieren von Loss-of-Function-Mutationen (Hsu et al., 2014) (Abb. 1). Die Keimbahnexpression von Cas9 und

sgRNA ist essentiell für die Erzeugung dieser erblichen Mutation. In C. elegans können Indel-Mutationen leicht

isoliert, wenn sie zu sichtbaren Phänotypen führen, wie Unc (unkoordinierte Fortbewegung) oder Dpy (dumpy body

Form). In ersten Experimenten schwankte die Effizienz dieses Ansatzes stark und reichte von 0,5 % bis 88 %

abhängig von verschiedenen sgRNAs (Tabelle 1). Wegen der Ineffizienz des Mutationsnachweises durch PCR, a

Die duale sgRNA-Methode, die zwei sgRNAs verwendet, die auf dasselbe Gen abzielen, wurde entwickelt, um größere

DNA-Deletionen, die möglicherweise zu vollständigen molekularen Nullmutationen führen (Chen et al., 2014 Xu and

Chisholm, 2014). Tatsächlich wurde berichtet, dass der duale sgRNA-Ansatz bis zu 24 kb zwischen

die sgRNAs (Chen et al., 2014).

Präzise Genom-Editierung durch Homology-Directed Repair

Im Vergleich zu NHEJ-Ereignissen, die ein Spektrum von Mutationen im Zielgebiet erzeugen, ist die HDR-vermittelte

Reparaturereignisse verwenden eine DNA-Vorlage, die eine Sequenzhomologie zur Genomstelle enthält, um gezielte

Modifikationen. Die HDR-abhängige Genombearbeitung kann verwendet werden, um eine präzise Punktmutation zu induzieren, add

Insertions-Tag (z. B. GFP, FLAG) für ein bestimmtes chromosomales Gen oder das gesamte Gen löschen und ersetzen

mit einem Genexpressionskonstrukt (z. B. GFP, antibiotische Genkassetten) (Abb. 1). Zahlreiche Berichte haben

wurde gezeigt, dass Cas9-induzierte DSBs effizient durch HDR in C. elegans repariert werden können (Chen et

al., 2013b Dickinson et al., 2013 Lo et al., 2013 Zhao et al., 2014 Dickinson et al., 2015).

Für eine erfolgreiche HDR wird auch eine Donor-DNA-Vorlage zusammen mit Cas9 und sgRNA im benötigt

Kern. Es gibt mehrere Strategien, um die Spenderschablone bereitzustellen. Der erste Ansatz ist die Verwendung von Plasmid

DNA-Templates, die verwendet werden könnten, um eine Vielzahl von DNA-Veränderungen zu erzeugen (Dickinson et al.,

2013). Das Klonieren der erforderlichen Homologiearme in einen Vektor kann jedoch Zeit in Anspruch nehmen. Eine attraktive Alternative

besteht darin, einzelsträngige Oligodesoxynukleotide (ssODNs) zu verwenden, die kommerziell synthetisiert werden können (Zhao et

al., 2014). Interessanterweise wurden PCR-generierte DNA-Fragmente erfolgreich als Donor-Template verwendet

(Paixet al., 2014). Eines der potentiellen Probleme der HDR-vermittelten Reparatur ist die geringe Effizienz (Paix et al.,

2014 Zhao et al., 2014). Obwohl es schwierig ist, genaue Schätzungen der Effizienz von HDR zu erhalten, ist insgesamt

aus diesen veröffentlichten Arbeiten wurden die rekombinanten Mutanten zwischen 0,4%―26,3% von F1 . identifiziert

Tiere (Dickinson et al., 2013 Tzur et al., 2013 Paix et al., 2014 Zhao et al., 2014) (Tabelle 1).

Interessanterweise wird die NHEJ-Aktivität durch RNAi-Inaktivierung des cku-80-Gens, das für C.

elegans stumpfendiges DNA-bindendes Protein (KU), kann die HDR-Effizienz signifikant verbessern (Ward, 2015).

Dennoch haben verfeinerte Methoden mit effizienterem HDR einen hohen Stellenwert für die Community.

Gewebe- oder stadienspezifische konditionale Knockout-Techniken sind wichtig, um den Fokus von Genen zu bestimmen

Funktion in vielzelligen Organismen. Mehrere Strategien wurden verwendet, um bedingte Mutationen zu erzeugen

in C. elegans, einschließlich des ortsspezifischen Rekombinase-basierten Cre-LoxP (Flavell et al., 2013) und Flp-FRT

(Voutev und Hubbard, 2008) oder gewebe- und stadienspezifische RNAi (Hannon, 2002). CRISPR-Cas9

System kann auch verwendet werden, um somatische Mutationen zu erzeugen, indem Cas9 in somatischen Zellen unter dem exprimiert wird

Kontrolle eines induzierbaren (z. B. Hitzeschock-Promotor, hsp-16) oder gewebespezifisch (z. B. neuronal, epidermal,

Muskel- und Darm)-Promotor (Liu et al., 2014 Shen et al., 2014). Interessanterweise wurde berichtet, dass

Die Cas9-Aktivität könnte sich über Generationen erstrecken, sobald das somatische Cas9-Transgen etabliert ist (Shen et al.,

2014), und vor allem kann diese somatische Mutation durch die Bereitstellung des GFP-Fusionsproteins gerettet werden (Li et al.,

2015). Durch die gezielte CRISPR-Cas9-DNA-Spaltung ermöglicht diese Methode die Untersuchung von

Funktionen essentieller Gene in der postembryonalen Entwicklung und bietet die Fähigkeit, Gewebe zu sezieren

spezifische Rollen eines einzelnen Gens (Shen et al., 2014 Li et al., 2015 Tian et al., 2015). Auch diese Studien

gezeigt, dass somatisches CRISPR-Cas9 im Vergleich zu anderen schnell, vielseitig und kostengünstig ist

bedingte Knockout-Techniken. Ein Vorbehalt ist jedoch, dass das somatische CRISPR-Cas9 eingeführt wurde

molekulare Läsionen sind wahrscheinlich heterogen und in der Regel auch auf DNA-Ebene nicht gut charakterisiert

Sequenz oder in zellulärer Verteilung. Darüber hinaus ist als erbliche Mutation die Effizienz der somatischen Mutation

scheint zwischen den Genen zwischen 10 und 90 % stark variabel zu sein (Shen et al., 2014 Li et al., 2015), was

kann vom sgRNA-Design abhängen. Negative oder partielle Ergebnisse bei gewebespezifischen Mutagenese-Ansätzen

ist derzeit mit Vorsicht zu genießen.

Trotz der Leistungsfähigkeit und Vielseitigkeit des CRISPR-Cas9-Systems ist das Potenzial für Off-

Zielspaltung und Mutagenese. CRISPR-Cas9 scheint relativ hohe Off-Target-Werte zu verursachen

Mutationen in menschlichen Zelllinien (Fu et al., 2013 Hsu et al., 2013). Interessanterweise war es jedoch

zeigten, dass die Cas9-induzierte Mutagenese in beiden Mausembryonen hochspezifisch ist (Wang et al.,

2013a Yang et al., 2013) und menschliche iPS-Zellen (Smith et al., 2014 Veres et al., 2014). Außerdem ganz

Genomsequenzierung und Untersuchung ausgewählter Off-Target-Loci hat noch keine Off-Target-Effekte in C.

elegans (Waaijers und Boxem, 2014). Off-Target-Mutagenese kann in normalen Zellen weniger problematisch sein

(Singh et al., 2015) sowie kleineres und weniger redundantes C. elegans-Genom. Trotz des geringen Risikos von

Off-Target sollte der Phänotyp der vom CRISPR-Cas9-System erzeugten Mutante mit Vorsicht analysiert werden.

und diese Zielspezifität kann nach den allgemeinen Regeln bestimmt werden, wie z. B. Rückkreuzung, unabhängig

Allele, die über mehrere sgRNAs generiert werden, und synonyme Mutationsrettung (Waaijers und Boxem, 2014

Li et al., 2015 Tian et al., 2015) .

ERHÖHTE EFFIZIENZ DER CRISPR-CAS9-VERMITTELTEN GENOME-BEARBEITUNG

Trotz mehrerer Berichte über hocheffiziente Mutagenese wurde deutlich, dass die Effizienz von

Das Targeting von CRISPR-Cas9 kann von Gen zu Gen und zwischen verschiedenen sgRNAs stark variieren. Viel Mühe

wird angewendet, um die Ursachen dieser Variation zu erkennen und die Effizienz der Reaktion zu steigern. Seit Cas9

gezielte DNA-Spaltung erfordert nur zwei Komponenten (Cas9 und die sgRNA), Strategien zur Verbesserung

Effizienz konzentrierten sich auf die Erhöhung der Cas9-Aktivität und der sgRNA-Bindungsaktivität.

Cas9 erzeugt stumpfendige DSBs nahe der PAM-Sequenz in einem Prozess, der durch zwei Nukleasen vermittelt wird

Domänen: HNH und RuvC, die den DNA-Strang komplementär und nicht-komplementär zum

sgRNA bzw. Mutationen einer der beiden Nukleasedomänen (H840A in HNH und D10A in

RuvC) ergeben eine Nickase-Aktivität von Cas9 (Cong et al., 2013 Jinek et al., 2012 Mali et al., 2013c), die

erzeugt einen Single Stranded Break (SSB), der über die High Fidelity Base Excision Repair (BER) repariert werden kann

(Dianov und Hubscher, 2013). Mehrere Studien an Säugetieren und Drosophila haben berichtet, dass

Ein Double-Nicking-Ansatz verbessert die Spezifität der DSBs auf dem Target durch Offset-Nicken erheblich

(Mali et al., 2013a Ran et al., 2013 Port et al., 2014). Darüber hinaus wird in Gegenwart eines Donor-Templates

DNA, die von diesen Nickasen gespalten wird, wird vorzugsweise durch HDR statt durch NHEJ repariert. Folglich,

Die Verwendung dieser Cas9-Nickasen erhöhte die Effizienz von HDR auf Kosten von NHEJ signifikant (Cong et

al., 2013 Mali et al., 2013c) im Vergleich zum Wildtyp Cas9. Bisher wurde die Nickase Cas9 nicht verwendet

berichtet bei C. elegans. Es wäre sehr interessant zu untersuchen, ob Cas9-Nickasen die

zielgerichtete Effizienz über den HDR bei C. elegans. Der Expressionspegel von Cas9 beeinflusst auch die Frequenz von

Mutantengeneration. Eine frühe C. elegans-Studie zeigte eine hohe Konzentration der Cas9-Expression

Plasmid in Injektion erhöht die Zielmutationen signifikant (Friedland et al., 2013). Somit Injektion von

in vitro synthetisierte mRNA oder Protein kann die Häufigkeit der Zielmutagenese aufgrund der

höhere Dosis von Cas9 im Keimbahnkern im Vergleich zu der nach Injektion eines Cas9-kodierenden

Plasmid (Tabelle 1) (Chiu et al., 2013 Cho et al., 2013 Katic und Grosshans, 2013).

Die andere wichtige und kritische Komponente des CRISPR-Cas9-Systems ist die Single Guide RNA, die

finden und binden an die anvisierten Genom-Loci. Eine Erhöhung der Bindungsaktivität von sgRNA kann die

CRISPR-basierte DNA-Spaltungseffizienz. Jüngste Fortschritte bei Säugetieren und C. elegans

Experimente zeigten, dass eine modifizierte sgRNA (E+F) (E, Haarnadelverlängerung F, A-U-Flip), die

eine erweiterte Cas9-bindende Haarnadelstruktur und für einen mutmaßlichen Pol III-Terminator (4 aufeinanderfolgende

U′s) in der sgRNA-Stammschleife durch einen A-U-Basenpaar-Flip, zeigt eine verbesserte Aktivität (Chen et al., 2013a

Bezirk, 2015). Ein weiterer provokativer Befund bei C. elegans ist, dass Leit-RNAs mit einem GG-Motiv am 3′Ende

der zielspezifischen Sequenzen kann die Häufigkeit der Mutagenese sowohl über NHEJ

und HDR (Farboud und Meyer, 2015). Die Kombination dieser beiden Strategien für das sgRNA-Design kann weitere Vorteile bringen

die Häufigkeit der Mutagenese erhöhen.

ERKENNUNG VON MUTATION DURCH EFFIZIENTE AUSWAHL

Auch wenn die CRISPR-Cas9-Mutagenese sehr effizient sein kann, ist es ebenso wichtig, die

Zeit und Arbeit, die für das Auffinden der mutierten Tiere aufgewendet wurde. CRISPR-Cas9-vermittelte Genom-Editierung kann

durch grundlegende molekulare Techniken wie PCR-Amplifikation der die DSBs umgebenden Stelle identifiziert.

PCR-Amplikons von F1-Nachkommen (und Co-Injektionsmarker-positiven) Würmern können dann mit einem

Endonuklease, die spezifisch fehlgepaarte DNA erkennt, wie T7-Endonuklease I oder CEL I. Es ist

auch relativ leicht zu identifizierende Heterozygoten für Deletionen, die durch dualen sgRNA-gerichteten Knockout erzeugt werden

(Chen et al., 2014 Xu und Chisholm, 2014). Durch Hinzufügen einer Restriktionsstelle zum Donor-Template kann HDR

basierte genomische Modifikation kann durch PCR mit anschließendem Enzymverdau leichter identifiziert werden

(Dickinson et al., 2013 Paix et al., 2014). Die genaue Mutation kann dann durch DNA-Sequenzierung gesucht werden.

Es ist wichtig zu beachten, dass jede in der PCR identifizierte Mutante in nachfolgenden Generationen bestätigt werden muss, um

Fehlalarme aufgrund von somatischen Mutationen vermeiden (Cho et al., 2013). In Fällen, in denen die Mutageneseeffizienz

niedrig, kann das PCR-Screening von F1-Mutanten arbeitsintensiv sein. Kürzlich wurde gezeigt, dass der Nachweis von

gezielte Mutanten könnten von der Verfeinerung mit der Kombination der C. elegans-Genetik profitieren. Mehrere

Es wurden vielversprechende Methoden etabliert, um sichtbare Phänotypen, Resistenzen gegen medikamentöse Behandlung oder

Selektionen für Marker, Minimierung der manuellen Arbeit, des Zeit- und Geldaufwands für das PCR-Screening

Sichtbare Phänotypauswahl

Die ersten Berichte über CRISPR-Cas9-vermittelte Genom-Editierung in C. elegans testeten Gene, deren Verlust von

Es war bekannt, dass diese Funktion sichtbare rezessive postembryonale Phänotypen wie Unc oder Dpy hervorruft.

Neu induzierte Mutationen könnten einfach durch die Isolierung von F1-transgenen Tieren identifiziert werden (mutmaßliche

Heterozygoten) und untersuchen ihre F2-Nachkommen auf den erwarteten Phänotyp (Friedland et al., 2013).

Mehrere andere Veröffentlichungen beschreiben ähnliche Strategien zur Isolierung von CRISPR-generierten Mutanten (Chiu et al., 2013

Cho et al., 2013). Insertionsmutationen könnten prinzipiell auch durch Rettung eines sichtbaren Phänotyps isoliert werden

wie Unc (Dickinson et al., 2013), wie sie erfolgreich bei der MosSCI-vermittelten Genom-Editierung (Frokjaer-

Jensen et al., 2008 Dickinson et al., 2013). Somit bietet eine sichtbare Phänotypauswahl, falls zutreffend, eine

einfache und leistungsstarke Methode, um gewünschte Mutationen zu erkennen.

Selection for antibiotic- or drug-resistance is a powerful means to find dominant resistant mutants.

Initially, several groups tested the efficiency of CRISPR-Cas9 targeted gene mutation using ben-1

(benomyl resistance-1) (Chen et al., 2013b Katic and Grosshans, 2013), encoding a tubulin whose loss-

of-function confers dominant resistance to benomyl. Comparable selections can also be used to identify

HDR events and simplify the screen strategy. Several exogenous antibiotic gene cassettes have been used

in C. elegans, such as neomycin, puromycin, hygromycin B and blasticidin. Selection and

counterselection strategies using HygR (hygromycin B-resistance gene) or BSD (blasticidin-resistance

gene) have been successfully applied to select animals with a transgene inserted by Cas9 via HDR (Chen

et al., 2013b Kim et al., 2014). In cases where HygR/BSD expression may disrupt the function of the

modified gene, the antibiotic gene cassette can be flanked with LoxP sites and removed by expression of

Cre recombinase. The delivery of Cre can be achieved either by subsequent microinjection of plasmid

(Dickinson et al., 2013), or by a heat-shock inducible promoter embedded in a self-excising drug selection

cassette (SEC) that was developed recently (Dickinson et al., 2015).

Fluorescence marker selection

C. elegans is effectively transparent, allowing fluorescence imaging in live animals and providing another

efficient positive selection strategy. Insertion of green fluorescent protein (GFP) to the CRISPR-Cas9

targeted site allows mutated animals to be identified by suitable fluorescence microcopy (Dickinson et al.,

2013 Tzur et al., 2013 Waaijers et al., 2013). Generated mutants in any fluorescence marker background

and identified morphology defects based on the fluorescence signal may provide another efficient way to

isolate the mutants. This simple selection strategy by visible fluorescent marker could significantly reduce

the hands-on screening work.

A hallmark of the natural CRISPR-Cas9 system is its ability to cleave multiple distinct targets

simultaneously and efficiently (Cong et al., 2013) within a single nucleus, the Cas9 protein can be

targeted to multiple genomic loci directed by different sgRNAs. Thus, use of a previously proven sgRNA

that results in an easily recognized visible phenotype may allow to identification of progeny of an animal

in which Cas9 was active. The validity of such multiplexing approaches is supported by the success of co-

CRISPR strategies, in which selection of animals with CRISPR-Cas9 induced NHEJ mutations at the unc-

22 locus enriched for CRISPR-Cas9 induced NHEJ events at a second unlinked locus (Kim et al., 2014).

This elegant co-CRISPR strategy not only significantly improved the frequency of detecting NHEJ events

(30%―80%), but also facilitated recovery of HDR events (10%―50%) (Kim et al., 2014). Such co-

CRISPR strategies should be very valuable in increasing efficiency in the generation of desired mutations,

and potentially without the necessity of extensive screening, or counter-selection.

Similar to co-CRISPR, in which CRISPR-Cas9 induced NHEJ mutation at the unc-22 locus increase the

efficient recovery of other NHEJ events (Kim et al., 2014), a co-conversion strategy was also invented to

efficiently recover HDR events in any gene in an otherwise unmarked genetic background (Arribere et al.,

2014). This strategy is also based on the idea that multiplex CRISPR of a marker gene, where HDR yields

an easily discernable phenotype, should enable identification of animals with the desired (unmarked)

mutation event, since such animals must have descended from a parental germline containing active Cas9,

guide RNA and donor DNA templates. Dominant mutations in morphological cuticle collagen genes such

as dpy-10(cn64), sqt-1(e1350) and rol-6(su1006) were induced and used to screen the F1 animals

(Arribere et al., 2014). In addition, rescue of a temperature sensitive lethal mutant pha-1(e2123) has also

been used as an alternate co-conversion selection marker for HDR events (Ward, 2015). In contrast to co-

conversion of dominant mutations, which does not depend on a specific genetic background, the pha-1(ts)

approach has to start with a mutant animal and results in restoration of a wild-type phenotype (Ward,

2015). These co-conversion methods significantly improved the efficiency up to 80% (Arribere et al.,

2014 Ward, 2015). The successes of these distinct variations of co-editing selection highlight the

robustness of CRISPR-Cas9 genome editing methods to detect the desired mutant. With this, it is

potential that any mutation of a gene could be made without any constraints on the genetic background,

minimizing the hands-on screening.

DESIGN CONSIDERATION AND IMPLMENTATION

It is less than two years since CRISPR-Cas9 was first reported in C. elegans, and the state of the art is in

rapid flux. Many variables and strategies have been tested in many laboratories, making it hard at times to

fairly compare the different approaches. However, some general considerations and advice can be put

forward. Based on the selection schemes summarized above, we can now design different approaches to

generate desired knock-ins and knock-outs, and some potential strategies are summarized in Table 3.

These approaches combine the advantages of current optimized selection methods. The main purpose of

all these strategies is: (1) to increase specificity and efficiency of mutagenesis, and (2) to minimize the

time and the hands-on labor needed to detect and recover mutants. As yet, no method can be absolutely

guaranteed to generate the desired mutation. Possibly the most important advice is that several different

sgRNAs should be tested using SUREYOR assay to compare the efficiency of the DNA cleavage, since

for any given gene or site a significant fraction of sgRNAs tested fail to induce any events (Arribere et al.,

2014 Kim et al., 2014). The basis of this variable effectiveness of sgRNAs remains unclear. The coupling

of optimized sgRNA design [3′ GG-guide RNA and sgRNA(E+F)] with co-CRISPR, co-conversion, or

recently designed SEC strategies may together strongly enhance mutagenesis and facilitate mutant

recovery (Dickinson et al., 2015 Farboud and Meyer, 2015).

The advent of CRISPR-Cas9 represents an effective next-generation method for programmable genome

editing, which will have significant impacts on future advancements in genetic manipulations in C.

elegans. It will change the way that we think of and perform the genetic and genomic analysis. Combined

with the power of C. elegans forward genetics, existing genetic mutants and powerful developmental

genetic tools that already available, the tractability of CRISPR-Cas9 offers researchers a versatile genome

editing tool to modify genes of interest. The CRISPR-Cas9 system is rapidly evolving, and fresh

developments are reported monthly. However, some applications of CRISPR-Cas9 have not been reported

in C. elegans. For example, catalytically inactive Cas9 fusion proteins can be targeted to specific DNA

loci to regulate gene transcription in other systems (Gilbert et al., 2013 Larson et al., 2013 Qi et al., 2013

Ji et al., 2014 Choudhary et al., 2015), but this inactive Cas9 regulated transcription has not been

described yet in C. elegans. CRISPR-Cas9 technology should also dramatically facilitate the use in other

nematodes lacking well-developed genetics, including species distantly related to C. elegans or parasitic

nematodes. A further application is to organelle inheritance. Mitochondria contain their own mtDNA

genomes and mitochondrial genetics is drastically different from the Mendelian genetics of nuclear genes.

mtDNA is present in multiple copies in different stage in C. elegans, ranging from

embryo and first three larvae stage to 780,000 copies in the adult stage (Lemire, 2005). Recently,

mitochondrial DNA has been mutated by mitochondrial-targeted TALENs (Bacman et al., 2013

Gammage et al., 2014 Reddy et al., 2015), suggesting potential ways to edit the mitochondrial genome.

Mitochondrial genome editing by Cas9 has not so far been reported, but may be another avenue for

CRISPR-Cas9 mediated targeted DNA editing not only in C. elegans but also in other systems. Indeed,

CRISPR-Cas9 significantly reduces the technological barrier for reverse genetics in any organism,

opening up a much wider arena for the genetic dissection of cellular processes.

I thank Dr. Andrew Chisholm for his critical reading and comments on this manuscript. I thank

Guangshuo Ou, Kyung Won Kim, Zhiping Wang and members of the Jin and Chisholm labs for

comments on the manuscript. S.X is an assistant project scientist in the Chisholm lab at the University of

California, San Diego. The work in the Dr. Andrew Chisholm’s lab is supported by National Institutes of

Health (NIH) grant R01 GM054657 to A.D.C.

Fig. 1. Diagram of CRISPR-Cas9 genome editing methodology in C. elegans.

Cas9 (dodger blue) and guided RNA (green) can be expressed in C. elegans germline by microinjecting

the mixture of plasmids, mRNA or combination of Cas9 protein and sgRNA mRNA. Successfully

expressed Cas9 and sgRNA will be assembled as a complex at its dsDNA target site. Two nuclease

domains RuvC and HNH cleave the DNA close to 5′ end of the PAM (yellow) sequence and generate

double-strand breaks (DSBs), which typically repaired by error-prone non-homologous end-joining

(NHEJ) or homology-directed repair (HDR). NHEJ can lead to the introduction of insertion/deletion

mutations (indels) (purple) of various lengths, which therefore disrupt gene function. HDR-mediated

repair can introduce specific point mutation or insert/delete desired sequences (red) through

recombination of the target locus with provided exogenous donor templates.

Arribere, J.A., Bell, R.T., Fu, B.X., Artiles, K.L., Hartman, P.S., Fire, A.Z., 2014. Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics 198, 837-846.

Bacman, S.R., Williams, S.L., Pinto, M., Peralta, S., Moraes, C.T., 2013. Specific elimination of mutant mitochondrial genomes in patient-derived cells by mitoTALENs. Nat. Med. 19, 1111-1113.

Barstead, R.J., Moerman, D.G., 2006. C. elegans deletion mutant screening. Methods Mol. Biol. 351, 5158.

Bassett, A.R., Tibbit, C., Ponting, C.P., Liu, J.L., 2013. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep. 4, 220-228.

Bassett, A.R., Liu, J.L., 2014. CRISPR/Cas9 and genome editing in Drosophila. J. Genet. Genomics 41, 7-19.

Belhaj, K., Chaparro-Garcia, A., Kamoun, S., Nekrasov, V., 2013. Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods 9, 39.

Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188, 773-782.

Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., Xiong, J.W., Xi, J.J., 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 23, 465-472.

Chen, B., Gilbert, L.A., Cimini, B.A., Schnitzbauer, J., Zhang, W., Li, G.W., Park, J., Blackburn, E.H., Weissman, J.S., Qi, L.S., Huang, B., 2013a. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479-1491.

Chen, C., Fenk, L.A., de Bono, M., 2013b. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res. 41, e193.

Chen, X., Xu, F., Zhu, C., Ji, J., Zhou, X., Feng, X., Guang, S., 2014. Dual sgRNA-directed gene knockout using CRISPR/Cas9 technology in Caenorhabditis elegans. Wissenschaft Rep. 4, 7581.

Cheng, Z., Yi, P., Wang, X., Chai, Y., Feng, G., Yang, Y., Liang, X., Zhu, Z., Li, W., Ou, G., 2013. Conditional targeted genome editing using somatically expressed TALENs in C. elegans. Nat. Biotechn. 31, 934-937.

Chiu, H., Schwartz, H.T., Antoshechkin, I., Sternberg, P.W., 2013. Transgene-free genome editing in Caenorhabditis elegans using CRISPR-Cas. Genetics 195, 1167-1171.

Cho, S.W., Lee, J., Carroll, D., Kim, J.S., 2013. Heritable gene knockout in Caenorhabditis elegans by direct injection of Cas9-sgRNA ribonucleoproteins. Genetics 195, 1177-1180.

Choudhary, E., Thakur, P., Pareek, M., Agarwal, N., 2015. Gene silencing by CRISPR interference in mycobacteria. Nat. Komm. 6, 6267.

Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., Zhang, F., 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339, 819-823.

Dianov, G.L., Hubscher, U., 2013. Mammalian base excision repair: the forgotten archangel. Nucleic Acids Res. 41, 3483-3490.

DiCarlo, J.E., Norville, J.E., Mali, P., Rios, X., Aach, J., Church, G.M., 2013. Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res. 41, 4336-4343.

Dickinson, D.J., Ward, J.D., Reiner, D.J., Goldstein, B., 2013. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat. Methods 10, 1028-1034.

Dickinson, D.J., Pani, A.M., Heppert, J.K., Higgins, C.D., Goldstein, B., 2015. Streamlined genome engineering with a self-excising drug selection cassette. Genetics doi:10.1534/genetics.115.178335

Doudna, J.A., Charpentier, E., 2014. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096.

Edgley, M., D'Souza, A., Moulder, G., McKay, S., Shen, B., Gilchrist, E., Moerman, D., Barstead, R., 2002. Improved detection of small deletions in complex pools of DNA. Nucleic Acids Res. 30, e52.

Farboud, B., Meyer, B.J., 2015. Dramatic enhancement of genome editing by CRISPR/Cas9 through improved guide RNA design. Genetics 199, 959-971.

Flavell, S.W., Pokala, N., Macosko, E.Z., Albrecht, D.R., Larsch, J., Bargmann, C.I., 2013. Serotonin and the neuropeptide PDF initiate and extend opposing behavioral states in C. elegans. Cell 154, 1023-1035.

Friedland, A.E., Tzur, Y.B., Esvelt, K.M., Colaiacovo, M.P., Church, G.M., Calarco, J.A., 2013. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat. Methods 10, 741-743.

Frokjaer-Jensen, C., 2013. Exciting prospects for precise engineering of Caenorhabditis elegans genomes with CRISPR/Cas9. Genetics 195, 635-642.

Frokjaer-Jensen, C., Davis, M.W., Ailion, M., Jorgensen, E.M., 2012. Improved Mos1-mediated transgenesis in C. elegans. Nat. Methods 9, 117-118.

Frokjaer-Jensen, C., Davis, M.W., Hollopeter, G., Taylor, J., Harris, T.W., Nix, P., Lofgren, R., Prestgard-Duke, M., Bastiani, M., Moerman, D.G., Jorgensen, E.M., 2010. Targeted gene deletions in C. elegans using transposon excision. Nat. Methods 7, 451-453.

Frokjaer-Jensen, C., Davis, M.W., Hopkins, C.E., Newman, B.J., Thummel, J.M., Olesen, S.P., Grunnet, M., Jorgensen, E.M., 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nat. Genet. 40, 1375-1383.

Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., Sander, J.D., 2013. Highfrequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechn. 31, 822-826.

Gammage, P.A., Rorbach, J., Vincent, A.I., Rebar, E.J., Minczuk, M., 2014. Mitochondrially targeted ZFNs for selective degradation of pathogenic mitochondrial genomes bearing large-scale deletions or point mutations. EMBO Mol. Med. 6, 458-466.

Gengyo-Ando, K., Mitani, S., 2000. Characterization of mutations induced by ethyl methanesulfonate, UV, and trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem. Biophys. Res. Komm. 269, 64-69.

Gilbert, L.A., Larson, M.H., Morsut, L., Liu, Z., Brar, G.A., Torres, S.E., Stern-Ginossar, N., Brandman, O., Whitehead, E.H., Doudna, J.A., Lim, W.A., Weissman, J.S., Qi, L.S., 2013. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 154, 442-451.

Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K., Harrison, M.M., Wildonger, J., O'Connor-Giles, K.M., 2013. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics 194, 1029-1035.

Hannon, G.J., 2002. RNA interference. Nature 418, 244-251.

Hsu, P.D., Lander, E.S., Zhang, F., 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278.

Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., Zhang, F., 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechn. 31, 827-832.

Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K., Peterson, R.T., Yeh, J.R., 2013. Heritable and precise zebrafish genome editing using a CRISPR-Cas system. PLoS One 8, e68708.

Ji, W., Lee, D., Wong, E., Dadlani, P., Dinh, D., Huang, V., Kearns, K., Teng, S., Chen, S., Haliburton, J., Heimberg, G., Heineike, B., Ramasubramanian, A., Stevens, T., Helmke, K.J., Zepeda, V., Qi, L.S., Lim, W.A., 2014. Specific gene repression by CRISPRi system transferred through bacterial conjugation. ACS Synth. Biol. 3, 929-931.

Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., Charpentier, E., 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821.

Katic, I., Grosshans, H., 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195, 1173-1176.

Kim, H., Ishidate, T., Ghanta, K.S., Seth, M., Conte, D., Jr., Shirayama, M., Mello, C.C., 2014. A coCRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197, 1069-1080.

Larson, M.H., Gilbert, L.A., Wang, X., Lim, W.A., Weissman, J.S., Qi, L.S., 2013. CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Nat. Protoc. 8, 2180-2196.

Lemire, B., 2005. Mitochondrial genetics. WormBook, 1-10.

Li, W., Teng, F., Li, T., Zhou, Q., 2013. Simultaneous generation and germline transmission of multiple gene mutations in rat using CRISPR-Cas systems. Nat. Biotechn. 31, 684-686.

Li, W., Yi, P., Ou, G., 2015. Somatic CRISPR-Cas9-induced mutations reveal roles of embryonically essential dynein chains in Caenorhabditis elegans cilia. J. Cell Biol. 208, 683-692.

Liu, P., Long, L., Xiong, K., Yu, B., Chang, N., Xiong, J.W., Zhu, Z., Liu, D., 2014. Heritable/conditional genome editing in C. elegans using a CRISPR-Cas9 feeding system. Cell Res. 24, 886-889.

Lo, T.W., Pickle, C.S., Lin, S., Ralston, E.J., Gurling, M., Schartner, C.M., Bian, Q., Doudna, J.A., Meyer, B.J., 2013. Precise and heritable genome editing in evolutionarily diverse nematodes using TALENs and CRISPR/Cas9 to engineer insertions and deletions. Genetics 195, 331-348.

Ma, Y., Zhang, X., Shen, B., Lu, Y., Chen, W., Ma, J., Bai, L., Huang, X., Zhang, L., 2014. Generating rats with conditional alleles using CRISPR/Cas9. Cell Res. 24, 122-125.

Maggio, I., Goncalves, M.A., 2015. Genome editing at the crossroads of delivery, specificity, and fidelity. Trends Biotechnol. 33, 280-291.

Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., Church, G.M., 2013a. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechn. 31, 833-838.

Mali, P., Esvelt, K.M., Church, G.M., 2013b. Cas9 as a versatile tool for engineering biology. Nat. Methods 10, 957-963.

Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., Church, G.M., 2013c. RNA-guided human genome engineering via Cas9. Science 339, 823-826.

Paix, A., Wang, Y., Smith, H.E., Lee, C.Y., Calidas, D., Lu, T., Smith, J., Schmidt, H., Krause, M.W., Seydoux, G., 2014. Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics 198, 1347-1356.

Plasterk, R.H., Groenen, J.T., 1992. Targeted alterations of the Caenorhabditis elegans genome by transgene instructed DNA double strand break repair following Tc1 excision. Embo J. 11, 287-290.

Port, F., Chen, H.M., Lee, T., Bullock, S.L., 2014. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proz. Nat. Akad. Wissenschaft USA 111, E2967-2976.

Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P., Lim, W.A., 2013. Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression. Cell 152, 1173-1183.

Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., Zhang, F., 2013. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380-1389.

Reddy, P., Ocampo, A., Suzuki, K., Luo, J., Bacman, S.R., Williams, S.L., Sugawara, A., Okamura, D., Tsunekawa, Y., Wu, J., Lam, D., Xiong, X., Montserrat, N., Esteban, C.R., Liu, G.H., Sancho-Martinez, I., Manau, D., Civico, S., Cardellach, F., Del Mar O'Callaghan, M., Campistol, J., Zhao, H., Campistol, J.M., Moraes, C.T., Izpisua Belmonte, J.C., 2015. Selective elimination of mitochondrial mutations in the germline by genome editing. Cell 161, 459-469.

Robert, V., Bessereau, J.L., 2007. Targeted engineering of the Caenorhabditis elegans genome following Mos1-triggered chromosomal breaks. Embo J. 26, 170-183.

Segal, D.J., Meckler, J.F., 2013. Genome engineering at the dawn of the golden age. Annu. Rev. Genomik Hum. Genet. 14, 135-158.

Shen, Z., Zhang, X., Chai, Y., Zhu, Z., Yi, P., Feng, G., Li, W., Ou, G., 2014. Conditional knockouts generated by engineered CRISPR-Cas9 endonuclease reveal the roles of coronin in C. elegans neural development. Abw. Cell 30, 625-636.

Singh, P., Schimenti, J.C., Bolcun-Filas, E., 2015. A mouse geneticist's practical guide to CRISPR applications. Genetics 199, 1-15.

Smith, C., Gore, A., Yan, W., Abalde-Atristain, L., Li, Z., He, C., Wang, Y., Brodsky, R.A., Zhang, K., Cheng, L., Ye, Z., 2014. Whole-genome sequencing analysis reveals high specificity of CRISPR/Cas9 and TALEN-based genome editing in human iPSCs. Cell Stem Cell 15, 12-13.

Tian, D., Diao, M., Jiang, Y., Sun, L., Zhang, Y., Chen, Z., Huang, S., Ou, G., 2015. Anillin Regulates Neuronal migration and neurite growth by linking RhoG to the actin cytoskeleton. Curr. Biol. 25, 11351145.

Tzur, Y.B., Friedland, A.E., Nadarajan, S., Church, G.M., Calarco, J.A., Colaiacovo, M.P., 2013. Heritable custom genomic modifications in Caenorhabditis elegans via a CRISPR-Cas9 system. Genetics 195, 1181-1185.

Veres, A., Gosis, B.S., Ding, Q., Collins, R., Ragavendran, A., Brand, H., Erdin, S., Cowan, C.A., Talkowski, M.E., Musunuru, K., 2014. Low incidence of off-target mutations in individual CRISPR-Cas9 and TALEN targeted human stem cell clones detected by whole-genome sequencing. Cell Stem Cell 15, 27-30.

Voutev, R., Hubbard, E.J., 2008. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. Genetics 180, 103-119.

Waaijers, S., Boxem, M., 2014. Engineering the Caenorhabditis elegans genome with CRISPR/Cas9. Methods 68, 381-388.

Waaijers, S., Portegijs, V., Kerver, J., Lemmens, B.B., Tijsterman, M., van den Heuvel, S., Boxem, M., 2013. CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans. Genetics 195, 1187-1191.

Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., Jaenisch, R., 2013a. Onestep generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153, 910-918.

Wang, Y., Li, Z., Xu, J., Zeng, B., Ling, L., You, L., Chen, Y., Huang, Y., Tan, A., 2013b. The CRISPR/Cas system mediates efficient genome engineering in Bombyx mori. Cell Res. 23, 1414-1416.

Ward, J.D., 2015. Rapid and precise engineering of the Caenorhabditis elegans genome with lethal mutation co-conversion and inactivation of NHEJ repair. Genetics 199, 363-377.

Wei, C., Liu, J., Yu, Z., Zhang, B., Gao, G., Jiao, R., 2013. TALEN or Cas9 - rapid, efficient and specific choices for genome modifications. J. Genet. Genomics 40, 281-289.

Wood, A.J., Lo, T.W., Zeitler, B., Pickle, C.S., Ralston, E.J., Lee, A.H., Amora, R., Miller, J.C., Leung, E., Meng, X., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., Meyer, B.J., 2011. Targeted genome editing across species using ZFNs and TALENs. Science 333, 307.

Xu, S., Chisholm, A.D., 2014. C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair. Abw. Cell 31, 48-60.

Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., Jaenisch, R., 2013. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell 154, 1370-1379.

Yu, Z., Ren, M., Wang, Z., Zhang, B., Rong, Y.S., Jiao, R., Gao, G., 2013. Highly efficient genome modifications mediated by CRISPR/Cas9 in Drosophila. Genetics 195, 289-291.

Zhao, P., Zhang, Z., Ke, H., Yue, Y., Xue, D., 2014. Oligonucleotide-based targeted gene editing in C. elegans via the CRISPR/Cas9 system. Cell Res. 24, 247-250.


Materialen und Methoden

C. elegans strains

The Bristol strain N2 was used as the standard wild-type strain. 27 The following mutant alleles were used in this work: unc-46(e177), mdf-1(gk2), dpy-5(s1300), dog-1(gk10), dhc-1(or283ts), dpy-10(e128), dpy-17(e164), dpy-13(e184), unc-119(ed3), ttTi5605, dotSi100, cxTi10882, dotSi110, such-4(h2168) and nT1[let-?(m435)]. The following strains were used in this work: N2 (Bristol strain as a wild-type), KR4233 [unc-46(e177) mdf-1(gk2) such-4(h2168)] KR3627 [unc-46(e177) mdf-1(gk2) V/nT1[let-?(m435)])] VC13 [dog-1(gk10)] EU1385 [dhc-1(or283ts)] JNC100 [unc-119(ed3) I dotSi100 II (T06E6.2 + unc-119(+)]] AZ212 [unc-119(ed3) ruIs32[unc-119(+) pie-1∷GFP∷H2B] III] and JNC144 [unc-119(ed3) I dotSi110 IV (T06E6.2 + unc-119(+)]]. Additional strains used in this work were generated in this study. Strains were maintained using standard protocol on nematode growth media (NGM) plates seeded with OP50 bacteria. 27 The strains were maintained at 20°C, while the phenotypic analyses were performed at both 20°C and 25°C as noted in the results section.

Mutation accumulation procedure and phenotypic analysis

The first suppressor, such-4, was isolated as previously described. 9 One clone from this strain, unc-46 mdf-1 such-4 dog-1 was outcrossed from the dog-1(gk10) background to avoid further accumulation of mutations and the KR4233 [mdf-1(gk2) such-4(h2168)] was generated and analyzed. 10,13 The second strain (JNC170) was maintained at 20ºC for 470 generations to allow further accumulation of mutations. Each generation 5 L4 hermaphrodites were transferred to a fresh plate. We also froze the worms at generations 170 (JNC168) and 270 JNC169). Then, at F170, F270 und F470 phenotypic analysis was performed for each strain. Ten L4 hermaphrodites were plated individually and analyzed for number of embryonic arrests, larval arrests, adults and fertile adults, as described previously. 9 In total, 5 to eight trials per strain were performed and SEM (standard error of the mean) was calculated and represented as error bars. Note that mdf-1(gk2) is linked to unc-46(e177) which results in an uncoordinated (Unc) phenotype and allows visual identification of mdf-1(gk2) homozygotes.

Genetic analysis of the unc-46 mdf-1 such-4 dog-1F470 Genom

To map suppressor mutations to a chromosome, we used Dpy (Dumpy) markers located in the central regions of the autosomes. To identify candidate genes in the mapped regions, we combined WGS and oaCGH analyses. Genomic DNA was prepared from JNC168, JNC169 and JNC170 following a standard protocol (http://www.genetics.wustl.edu/tslab/Protocols/genomic_DNA_prep.htm) originally set up by Andy Fire's Laboratory. For the WGS, using Illumina Solexa technology, libraries were prepared and sequenced at Canada's Michael Smith Genome Sciences Center for JNC170 and Simon Fraser University for JNC168 and JNC169. oaCGH analysis was performed as described by Maydan and colleagues 28 using the newly designed 3-plex microarray (120618_Cele_WS230_JK_CGH), manufactured by Roche NimbleGen Inc. Detailed methods on bioinformatics analysis of the WGS and oaCGH data will be published separately.

Phenotypic analysis of dhc-1

dhc-1(dot168) was separated from other accumulated mutations in the unc-46 mdf-1 such-4 dog-1F470 genome by extensive backcrossing to N2 and using the tetra-primer ARMS-PCR 20 to select for dhc-1(dot168) homozygotes after each backcross. The following primers were designed and used for tetra-primer ARMS-PCR: C allele: AGCAAAGGAAAGATTCTTGATGATAAGTC T allele: TCTTCAGTTTTTCGAGAGTTTCAATAAACA Out_F:CCAGATCTTTATGATCACTCGTGATTC Out_R:AATCTCATTGAGCTGTTGTAGAGTGTGA. Using these primers, homozygous dhc-1(dot168) is recognizable by 2 PCR-bands, 439 bp of the 2 outer primers and 299 bp of the mutant allele N2 homozygotes also produce the 439 bp band, but a 199 bp band for the wild-type allele heterozygotes produce 3 bands (439 bp, 299 bp and 199 bp). First, JNC170 was crossed to N2 and dhc-1(dot168) homozygotes that did not have unc-46(e177) mdf-1(gk2), dog-1(gk10) und such-4(h2168) alleles were selected. Then these dhc-1(dot168) homozygotes were backcrossed to N2 worms an additional 9 times. After each outcross, homozygous dhc-1(dot168) animals were selected. After the final outcross phenotypic analyses and genetic interaction studies were performed.

To assess whether dhc-1(dot168) und dhc-1(or283ts) could suppress the lethality and sterility of mdf-1(gk2), the F1 mdf-1(gk2) homozygotes, segregated from KR3627 (unc-46(e177) mdf-1(gk2) V/nT1[let-?(m435)]) strain were mated to either dhc-1(dot168) oder dhc-1(or283ts) males. The phenotypically wild-type l unc-46(e177) mdf-1(gk2)/ + + dhc-1/ + hermaphrodites were allowed to self-fertilize and Unc-46 progeny were plated individually. All of the worms that propagated for more than 3 generations were genotyped and confirmed to be homozygous for dhc-1, while none of the worms that did not be propagated for longer than 3 generations were homozygous for dhc-1.

To construct unc-46(e177) mdf-1(gk2) such-4(h2168) dhc-1(dot168) we mated dhc-1(dot168) males to KR4233 (unc-46(e177) mdf-1(gk2) such-4(h2168)) hermaphrodites and screened for Unc-46 worms. The Unc-46 worms were then analyzed using PCR and gk2, h2168, dot168 homozygotes were kept. The primers and procedure used to track gk2 und h2168 homozygotes were published previously. 9,10 Using the MosSCI method 23 we generated a strain (JNC100) that contains 2 copies of cyb-3 gene. 10 To eliminate the possibility that potential background mutations in KR4233 would interfer with our results, we also constructed unc-46(e177) mdf-1(gk2) dhc-1(dot168) cyb-3 dup (dotSi100). Analysis of this strain revealed similar results to the unc-46(e177) mdf-1(gk2) such-4(h2168) dhc-1(dot168) strain (data not shown). To construct unc-46(e177) mdf-1(gk2) cyb-3(dotSi100) cyb-3(dotSi110) dhc-1(dot168) we mated dhc-1(dot168) males to unc-46(e177) mdf-1(gk2) cyb-3(dotSi100) cyb-3(dotSi110) hermaphrodites then screened for Unc-46 worms. The Unc-46 worms were then analyzed using PCR and gk2, dotSi100, dotSi110, dot168 homozygotes were kept. The primers and procedure used to track dotSi100, dotSi110 homozygotes were published previously. 10,24

Phenotypic analysis of the constructed strains was performed as follows hermaphrodites at L4 stage were grown on fresh OP50 plates at 20⁰C or 25⁰C. The hermaphrodites were transferred to fresh plates every 12 hours. Brood size was calculated based on the total eggs laid by each hermaphrodite. Embryos that did not hatch were scored as embryonic arrests, while the embryos that hatched but did not grow to adult stage were scored as larval arrests. The embryos that developed into adults were analyzed for the presence of males in all the strains analyzed, while all the mdf-1(gk2)-allele containing strains were also analyzed for the percent of the sterile adult progeny by individually plating all the adult progeny and scoring the presence or absence of offspring.

Anaphase onset timing in the early embryo

One-day old gravid adult hermaphrodites were dissected and embryos were mounted onto 3% agarose pads as described previously. 29 Embryos were observed using a Quorum WaveFX Spinning Disk system mounted on Zeiss Axioplan microscope. Early embryonic cell division was recorded using time-lapse video microscopy at 400x, with 200 ms fluorescent exposure, one image every 10 seconds. Image acquisition and analysis was performed using the Volocity software package.

QRT-PCR

qRT-PCR analysis was performed on genomic DNA from wild-type (N2), KR4233, JNC168, JNC169 and JNC170. Three internal references were used, eif-3, cdc-42 and mdh-1 following the procedures described previously. 30 Mean values and standard deviations of relative ratios from four replicates are shown. Each qRT-PCR reaction contained 50 ng of genomic DNA, 10 μL of 2x SYBR Green Supermix (Biorad), and 1 μM of each primer. qRT-PCR reactions were run in quadruplicate on a Biorad MyIQ Real-time thermocycler. Data were normalized using the 3 internal references and the relative fold change was calculated using the ΔΔCt method. All primers were tested on serial dilutions and primer efficiency was calculated.

Tabelle 1. dhc-1 suppresses mdf-1(gk2) lethality and sterility


Schlussfolgerungen

Molting is a complex developmental process that is carried out in all nematodes, as well as in many other invertebrate species. Molting allows for the replacement of the apical ECM, known as the cuticle, thereby enabling growth or developmental specialization. As described above, a large and diverse collection of genes have been implicated in molting control in C. elegans (Table 1). However, a clear and integrated description of the molting cascade is still missing within nematode species. Further studies will undoubtedly lead to a better understanding of this important developmental process.

Beyond an interest in understanding molting as a developmental process, molting studies may have other significant and practical applications. Notably, molting is a potential focus for antihelminthic drug development, both for human and veterinary medicine. 143-145 Diseases caused by nematodes are still widely distributed in the human population and affect hundreds of millions of people, according to the World Health Organization. 146 Nematode infections can lead to a number of long-term consequences, including death, and can further complicate other diseases. Many of these diseases are zoonoses, meaning that they are naturally transmissible from vertebrate animals to humans. Correspondingly, nematode infections of animals, as well as plants, have significant economic consequences. 147,148 As such, agricultural industries use extensive prophylactic measures to decrease the prevalence of parasitic nematodoses, which cause material damage and financial loss.

Although molting in nematodes might seem to constitute a specialized biological process within invertebrates, understanding the molecular basis for ECM remodeling and other fundamental events associated with molting has broad relevance for biology and our basic knowledge of disease states. Furthermore, because the C. elegans cuticle is largely collagen based, it is potentially useful for understanding dermal physiology and wound healing in higher eukaryotes. 149 In addition, primary tumor invasion through the ECM is an important process during tumor metastasis and shares many conserved features with ECM remodeling. 150-152 Notably, many genes implicated in C. elegans molting have orthologs in higher eukaryotes, indicating that this biological system represents a powerful tool for exploring the functions and molecular mechanisms underlying a wide range of conserved cellular and developmental processes.

Tabelle 1. C. elegans genes implicated in molting that are discussed in this review.


Schau das Video: ELASTIZITÄT berechnen. Nachfrage: Preiselastizität, Einkommenselastizität + Punktelastizität (Juli 2022).


Bemerkungen:

  1. Shadwell

    Verständlicherweise vielen Dank für Ihre Unterstützung in dieser Angelegenheit.

  2. Arashit

    Ich denke du liegst falsch. Lass uns diskutieren. Maile mir eine PM, wir reden.

  3. Nijas

    Ich glaube, Sie machen einen Fehler.

  4. Herve

    Es tut mir leid, aber meiner Meinung nach werden Fehler gemacht. Wir müssen diskutieren.

  5. Brandelis

    Ich gratuliere, die helle Idee

  6. Voliny

    Und was machen wir ohne Ihren hervorragenden Satz



Eine Nachricht schreiben