Information

Gibson-Assembly - Primer-Design mit A- und T-reichen Regionen


Ich habe eine Frage zur Gibson-Montage. Ich habe es mehrmals gemacht und es hat bei uns immer gut funktioniert, aber jetzt möchte ich ein Fragment zusammensetzen, das eine Sequenz wie folgt hat: 5'CTTTTTCTTCGTCGAAAAAGGCAATAAAAATTTTTATCACGTTTCTT3'.

Glaubst du, dass eine AA- und TT-Wiederholung Probleme bereiten wird? Wir verwendeten normalerweise 30 bp Homologie auf beiden Seiten der Sequenz. Sollte ich in diesem Fall mehr verwenden? Wie sind Ihre Erfahrungen mit diesen sich wiederholenden AT-Sequenzen?

Danke, Martin Kavšček


Fehlerbehebung bei Ihrem Plasmidklonierungsexperiment

Das Klonen kann ein ziemlich mühsamer Prozess sein. Die PCR kann möglicherweise kein Produkt produzieren, die Transformation führt möglicherweise nicht zu Zellen oder alle gescreenten Kolonien enthalten möglicherweise nicht das richtige Plasmid. Es kann viel schief gehen! Neben allen Schritten des Klonvorgangs gibt es auch viele Möglichkeiten zur Fehlerbehebung beim Klonexperiment. Hier sind einige Tipps, die Ihnen bei Ihrem Klonierungsprojekt helfen und hoffentlich ohne wesentliche Verzögerungen Ihr begehrtes Plasmid erhalten.


Zugangsoptionen

Erhalten Sie vollen Zugriff auf Zeitschriften für 1 Jahr

Alle Preise sind Nettopreise.
Die Mehrwertsteuer wird später an der Kasse hinzugefügt.
Die Steuerberechnung wird während des Bezahlvorgangs abgeschlossen.

Erhalten Sie zeitlich begrenzten oder vollständigen Artikelzugriff auf ReadCube.

Alle Preise sind Nettopreise.


Vorteile der GeneArt Gibson Assembly Cloning-Technologie

GeneArt Gibson EX-Montagesätze sind ideal für die Montage mehrerer Einsätze.

Abbildung 1. GeneArt Gibson Assembly EX Cloning Kits bieten Optionen für eine hohe Transformationseffizienz, wenn eine größere Anzahl von Inserts verwendet wird. Zusammenbau von 6, 8 und 10 Fragmenten von 0,5 kb in pcDNA 3.4, transformiert in Invitrogen TOP10 kompetente Zellen.

GeneArt Gibson Assembly HiFi Kits bieten eine sehr kostengünstige und effiziente Möglichkeit, kleinere Stückzahlen zusammenzubauen. Für größere Baugruppen stehen die GeneArt Gibson EX Master Mixes und Kits zur Verfügung.

Abbildung 2. GeneArt Gibson Assembly HiFi-Kits bieten eine hohe Kloneffizienz unter Verwendung eines einzelnen Inserts für mehrere Insert-Designs. Zusammenbau von 1, 2 und 4 - 1 kb Fragmenten in pCDNA 3.4 unter Verwendung von TOP10 kompetenten Zellen. GeneArt Gibson Assembly HiFi Kits sind die kostengünstigste und zeitsparendste Methode zum Bau großer Baugruppen, insbesondere wenn sie mit GeneArt Strings DNA Fragments oder 100 % sequenzierter GeneArt Gensynthese verwendet werden.


Die Ursache Ihrer Probleme

Problem 1. Stabilität: thermisch und strukturell

GC-reiche DNA-Sequenzen sind stabiler als Sequenzen mit niedrigem GC-Gehalt. Für die PCR bedeutet dies: Je höher der GC-Gehalt, desto höher der Schmelzpunkt der DNA. Unter Druck, beispielsweise bei Hitzeeinwirkung, können die GC-reichen Sequenzen weitaus stärker missbraucht werden als die GC-niedrigen Sequenzen. Während die mögliche Rolle von Meditation und Yoga eine beruhigende Wirkung auf diese Grundlagen hat, die es ihnen ermöglicht, mehr Missbrauch zu ertragen und trotzdem zusammenzuhalten, wurde noch nicht untersucht, wie sich ihre Struktur auswirkt. GC-reiche DNA-Sequenzen sind stabiler als Sequenzen mit niedrigem GC-Gehalt, aber entgegen der landläufigen Meinung sind die Wasserstoffbrücken nicht der Hauptgrund für diese Stabilität. Die Stabilisierung ist hauptsächlich auf Stapelwechselwirkungen zurückzuführen, die als Basisstapelung bezeichnet werden. Dahinter steckt eine schöne Biochemie und Biophysik und wenn Sie interessiert sind, gibt es eine fantastische Erklärung dafür, warum diese Stapelung auftritt.

Lustige Tatsache! Deshalb Thermophilus, ein Extremophil, hat ein GC-reiches Genom, auch Regionen unseres Genoms (natürlich vorausgesetzt, Sie sind ein Mensch), die sehr oft transkribiert werden müssen, wie z - ordentlich oder?!

Problem 2. Bildung von Sekundärstrukturen

Dieser Punkt ist stark an den ersten Punkt gebunden. Wenn GC-reiche Regionen Sekundärstrukturen bilden, insbesondere Haarnadelschleifen, sind sie sehr stabil und bleiben daher hängen und sammeln sich an. Diese schmelzen bei üblichen PCR-Denaturierungstemperaturen nicht gut. Darüber hinaus neigen Primer, die zur Amplifikation von GC-reichen Regionen verwendet werden, dazu, Selbst- und Kreuzdimere sowie Stemloop-Strukturen zu bilden, die das Fortschreiten der DNA-Polymerase entlang des Matrizenmoleküls behindern können, was zu verkürzten PCR-Produkten führt. GC-reiche Sequenzen am 3'-Ende von Primern können ebenfalls zu Fehlpriming führen.

Puff! *die Geräusche Ihres Vertrauens in Ihre Fähigkeit, eine PCR-Entleerung durchzuführen*

Aber warte! Wir haben einige Lösungen für Sie!

Lösung 1. Erhöhen Sie Ihre Schmelztemperatur

Dies ist (theoretisch) eine sehr vernünftige Lösung. Je höher die Temperatur, desto wahrscheinlicher trennen sich diese störenden Sekundärstrukturen, die von GC-reichen Regionen gebildet werden. Dies führt jedoch zu geringeren Produktausbeuten, da Ihre taq beginnt bei Temperaturen über 92,5 °C schneller zu denaturieren, daher ist es ratsam, nur in den ersten Zyklen höhere Schmelztemperaturen zu verwenden und über 95 °C zu vermeiden. Es kann einiges Herumspielen erfordern, aber diese Lösung ist ein guter Ausgangspunkt.

Lösung 2. Anpassen Ihrer Magnesiumkonzentration

Unspezifische Amplifikation kann im Allgemeinen durch die Verwendung zu hoher Magnesiumkonzentrationen (Mg) verstärkt und sogar verursacht werden. Testen Sie daher die optimale Konzentration mit Gradienten- oder Titrations-PCR. Kurz gesagt, Ihr Brunnen ganz links enthält weniger als Sie denken, dass er funktionieren wird, und Ihr Brunnen ganz rechts enthält eine übermäßige Menge an Magnesium mit einem Gradienten in der Mitte, damit Sie die geringstmögliche Menge bestimmen können, die Sie verwenden können Ihr Produkt erreichen.

Lösung 3. Einen Freund anrufen:

Ich habe ein paar Rezepte online gefunden, die verschiedene Labore für gut befunden haben:

  1. Zugabe von 3-10% Dimethylsulfoxid (DMSO), meistens 5%
  2. Zugabe von 1 M Betain und 5% DMSO – diese können Ihre Enzymaktivität reduzieren, also fügen Sie zusätzliches Enzym hinzu
  3. Zugabe von Betain (Sigma), DMSO, DTT und BSA
  4. Addition von Ethylenglykol mit 1,2-Propandiol
  5. Zugabe von 5 % DMSO und 1,25% Formamid oder nur Formamid
  6. Zugabe von 5 – 10 % absolutes Glycerin und höhere Glühtemperatur
  7. Verwenden Sie normalen HotStart und fügen Sie 2 Mio. Betain hinzu
  8. Verwenden Sie Kapa’s HiFi Hot Start Enzym
  9. Verwenden Sie das KAPA3G GC Rich Kit mit 5 % DMSO
  10. GC-Enhancer, die in verschiedenen Kits wie diesem Clontech, Epicenter und Qiagen erhältlich sind, bieten auch Kits für dieses Problem an, wenn Sie etwas Geld übrig haben.

Einige dieser Optionen sind hier mit Links zu Referenzen schön zusammengefasst. Wir haben auch einen Beitrag, der verschiedene PCR-Additive beschreibt und wie sie Ihnen helfen können.

Lösung 4. Andere Arten von PCR

  1. Nested-PCR: Ich habe vollständig über diese Technik geschrieben, also bleib dran!
  2. Slowdown-PCR: hier erforscht.
  3. Hot-Start-PCR.
  4. Long-Range-PCR: Clontech und Qiagen bieten beide Kits für dieses Problem an, wenn Sie etwas Geld übrig haben.

Diese und andere Formen der PCR werden hier einfach und kurz beschrieben.

Sie haben also jede Menge Möglichkeiten! Lassen Sie uns in den Kommentaren unten wissen, was für Sie funktioniert hat.

Basisstapelung: Kool ET. (2001)Wasserstoffbrücken, Basenstapelung und sterische Effekte bei der DNA-Replikation. Annu Rev Biophys Biomol Struct. 30:1–22.

Ethylenglykol mit 1,2-Propandiol: Zhizhou, Z. et al. (2009)Verbesserte Amplifikation von GC-reicher DNA mit zwei organischen Reagenzien. BioTechniken 47,3: 775-79. Netz

Verwendung von Formamid in der PCR: Sarkar, G., et al. (1990). Formamid kann die Spezifität der PCR dramatisch verbessern. Nukleinsäureforschung, 7465-7465.


Golden Gate-Versammlung

Golden Gate Assembly verwendet zwei Restriktionsenzyme vom Typ IIS, die DNA außerhalb der eigentlichen Erkennungsstelle für das Enzym schneiden. Die Erkennungsstellen sind durch mindestens ein Basenpaar vom Sequenzüberhang getrennt, wodurch keine Narbenbildung der DNA-Sequenz gewährleistet ist, da die Überhangsequenz nicht durch das Restriktionsenzym diktiert wird. Wenn die Erkennungssequenz nicht palindrom ist, können Sie mehrere Fragmente gleichzeitig und geordnet zusammenfügen. Da die Restriktionsstelle während der Reaktion verändert wird, können außerdem Verdau und Ligation gleichzeitig in einem Röhrchen erfolgen. Daher wird diese Methode oft als „One-Pot-Wonder“ bezeichnet.

Der Golden Gate-Ligationsprozess ist dank der Wiederverdauungsmechanismen nahezu 100% effizient. Außerdem wird eine erneute Ligation verhindert, da die Spaltung außerhalb von Restriktionsenzymstellen diese aus dem Produkt entfernt. Sie können jedoch feststellen, dass das Entwerfen der richtigen Überhangsequenzen mühsam sein kann und Golden Gate Assembly viel weniger sequenzunabhängig ist als andere Klonmethoden. Trotz dieser Einschränkungen eignet sich Golden Gate Assembly besonders gut für die Konstruktion kombinatorischer Bibliotheken, in denen jedes Fragment von denselben zwei Überhangsequenzen flankiert wird.


Generierung von Plasmidvektoren, die FLAG-markierte Proteine ​​unter der Regulation des humanen Elongationsfaktor-1α-Promotors exprimieren, unter Verwendung von Gibson-Assembly

Die Gibson-Assembly-(GA)-Klonierung bietet eine schnelle, zuverlässige und flexible Alternative zu herkömmlichen DNA-Klonierungsverfahren. Wir verwendeten GA, um maßgeschneiderte Plasmide für die Expression exogener Gene in embryonalen Stammzellen der Maus (mESCs) zu erstellen. Die Expression exogener Gene unter der Kontrolle der SV40- oder humanen Cytomegalovirus-Promotoren nimmt nach Transfektion in mESCs schnell ab. Ein Heilmittel für diese verminderte Expression besteht darin, den humanen Elongationsfaktor-1 alpha (hEF1α)-Promotor zu verwenden, um die Genexpression zu steuern. Plasmidvektoren, die hEF1α enthalten, sind nicht so weit verbreitet wie SV40- oder CMV-enthaltende Plasmide, insbesondere solche, die auch N-terminale 3xFLAG-Tags enthalten. Das hier beschriebene Protokoll ist ein schnelles Verfahren zur Erzeugung von Plasmiden, die FLAG-markiertes CstF-64 und CstF-64-Mutanten unter der Expressionsregulation des hEF1α-Promotors exprimieren. GA verwendet eine Mischung aus DNA-Exonuklease, DNA-Polymerase und DNA-Ligase, um das Klonen überlappender Enden von DNA-Fragmenten zu ermöglichen. Basierend auf den uns zur Verfügung stehenden Template-DNAs haben wir unsere Konstrukte so entworfen, dass sie zu einer einzigen Sequenz zusammengesetzt werden. Unser Design verwendete vier DNA-Fragmente: pcDNA 3.1-Vektorrückgrat, hEF1α-Promotorteil 1, hEF1α-Promotorteil 2 (der 3xFLAG-Tag enthielt, der als doppelsträngiges synthetisches DNA-Fragment gekauft wurde) und entweder CstF-64 oder eine spezifische CstF-64-Mutante. Die Sequenzen dieser Fragmente wurden in ein Primer-Erzeugungswerkzeug hochgeladen, um geeignete PCR-Primer zum Erzeugen der DNA-Fragmente zu entwerfen. Nach der PCR wurden DNA-Fragmente mit dem Vektor vermischt, der den selektiven Marker enthielt, und die GA-Klonierungsreaktion wurde zusammengestellt. Plasmide aus einzelnen transformierten Bakterienkolonien wurden isoliert. Das anfängliche Screening der Plasmide erfolgte durch Restriktionsverdau, gefolgt von Sequenzierung. Zusammenfassend lässt sich sagen, dass GA es uns ermöglichte, innerhalb von 5 Tagen maßgeschneiderte Plasmide für die Genexpression zu erstellen, einschließlich Konstrukt-Screenings und Verifizierung.


Gibson-Assembly - Primer-Design mit A- und T-reichen Regionen - Biologie

Designer-Simulator für molekulares Klonen

Eine neuartige All-in-One-Plattform für Design, Simulation und Management des molekularen Klonens mit einzigartigem Flussdiagramm-Design.

Bitte beachten Sie diese Publikation, wenn Sie MCDS in Ihrer Forschung verwendet haben: http://dx.doi.org/10.1016/j.meteno.2016.05.003

Abstrakt: Mit der Entwicklung der synthetischen Biologie werden DNA-Manipulationen immer komplexer. Obwohl eine Reihe von Softwareprogrammen für das molekulare Klonierungsdesign verfügbar sind, haben sie alle Nachteile im Zusammenhang mit der Verwaltung der komplexen Klonierungs- und genetischen Modifikationsprozesse, die heute in der modernen Molekularbiologie Routine sind. Um die aktuellen Einschränkungen zu beheben, haben wir eine leistungsstarke neue All-in-One-Softwareplattform entwickelt, die Design, Simulation und Management auf Projektebene mit einer neuartigen interaktiven Flussdiagramm-Benutzeroberfläche ermöglicht. Zusätzlich zu den Standardfunktionen verfügt es über eine Reihe von Funktionen, die entweder einzigartig sind oder in keinem Softwarepaket kombiniert zu finden sind: (1) Es verfügt über eine interaktive Flussdiagramm-Benutzeroberfläche für komplexe mehrstufige Prozesse, die eine integrierter Überblick über das gesamte Projekt (2) Es kann einen benutzerdefinierten Workflow von Klonierungsschritten in einer einzigen Ausführung der Software ausführen (3) Es kann mehrere Arten des genetischen Rekombinierens verarbeiten, eine Technik, die das klassische Klonen für viele Anwendungen schnell ersetzt und (4) es enthält experimentelle Informationen, um die Arbeit im Nasslabor bequem zu leiten, und kann Ergebnisse und Kommentare speichern, um die Verfolgung und Verwaltung des gesamten Projekts auf einer Plattform zu ermöglichen. MCDS kann die meisten Klonierungstechniken des allgemeinen molekularen Klonens, der Gentechnik und der synthetischen Biologie entwerfen, simulieren, verwalten und aufzeichnen, einschließlich rekombinanter DNA-Technologie, SLIC (Sequence and Ligation Independent Cloning), Golden Gate, Gateway Cloning, Gibson Isothermal Assembly, Hefehomologe Rekombination für DNA-Assemblierung, ortsspezifische Rekombination und chromosomale Integration, PhiC31-Assemblierung, Lambda-Red-Knock-out/-Knock-in und CRISPR-Verdau. Die Flussdiagrammorganisation ermöglicht eine einfache Verfolgung und Verwaltung dieser komplexen Experimente.

.Net Framework 4.6 muss vor dem Ausführen von MCDS installiert werden (wenn Sie Windows 8 oder niedriger verwenden).


Hintergrund

Die Hefe Pichia pastoris (syn. Komagataella spp.) wird häufig zur Herstellung heterologer Proteine ​​eingesetzt, von denen die meisten effizient sezerniert werden [1]. Es wird auch für die Herstellung von Membranproteinen [2], Pharmazeutika und chemischen Verbindungen [3] und als Modellorganismus für die biomedizinische Forschung [4] bevorzugt. Neue genetische Werkzeuge für P. pastoris wie Promotoren, Signalpeptide, Selektionsmarker, Flp-frt/Cre-lox-Rekombination und CRISPR/Cas9 wurden kürzlich untersucht [3]. Im Vergleich zu anderen Hefearten P. pastoris zeichnet sich durch seine Methylotrophie, seinen Crabtree-negativen Metabolismus, sein Wachstum zu sehr hohen Zelldichten, die geringe Anzahl und Konzentration sezernierter Wirtszellproteine ​​[5] und die Verfügbarkeit vieler genetischer Werkzeuge und industriell relevanter Stämme (humanisierte N-Glykosylierung, Proteasemangel) [6]. Die genomische Integration in spezifische Loci erfolgt üblicherweise unter Verwendung von 5'- und 3'-homologen Regionen und hängt entscheidend von der Vermeidung repetitiver homologe Regionen und der Verwendung von gut gereinigter Vektor-DNA ab [7].

Zur rekombinanten Proteinproduktion in P. pastoriswurden verschiedene hocheffiziente Promotorsysteme etabliert (Übersicht von Weinhandl et al. [8]) und zur Herstellung von bis zu mehreren Gramm pro Liter sezernierter heterologer Produkte angewendet, die sowohl Proteine ​​für biopharmazeutische Zwecke als auch industrielle Enzyme umfassen [9]. Der Methanolverwertungsweg (MUT) von P. pastoris ist sehr effizient und die entsprechenden Gene werden auf Methanol stark induziert [10, 11]. MUT-Promotoren (z.B. P AOX1, P DAS1/2 und P FLD1) sowie starke konstitutive Promotoren von stark exprimierten Genen (wie z P LÜCKE, abgeleitet vom Glyceraldehyd-3-Phosphat-Dehydrogenase-Gen TDH3 und der Promotor des Translationselongationsfaktors P TEF1) werden häufig angewendet [12]. Dennoch gibt es noch Raum für eine weitere Verbesserung der Produktivität und/oder Proteinqualität. Neben der Erhöhung der Transkriptionsstärke durch die Verwendung starker Promotoren und höherer Genkopienzahlen der Expressionskassetten erwies sich auch das Zell-Engineering zur Steigerung der Faltungs- und Sekretionskapazität des Wirts oder zur Bereitstellung von Vorläufern und Energie für diese Prozesse als vorteilhaft für die Erhöhung der Produkttiter (Übersicht von Puxbaum et al. [1]). Manchmal erfordern solche Zell-Engineering-Ansätze die gleichzeitige Überexpression von mehr als einem Gen, um ihr volles Potenzial zu entfalten (z. B. Nocon et al. [13], Delic et al. [14]). Andererseits können Gen-Knock-outs notwendig sein, um schädliche Prozesse wie den Transport in die Vakuole oder die Proteolyse zu vermeiden (z. B. Idiris et al. [15]). Beide genetischen Manipulationen erfordern umfangreiche Klonierungs- und Transformationsarbeiten, was sie ziemlich zeitaufwändig und mühsam macht.

Heutzutage werden fortschrittliche Werkzeuge der synthetischen Biologie in allen Bereichen der Mikrobiologie eingesetzt. Neue Klonierungsmethoden wie Gateway®, Gibson Assembly und Golden Gate Cloning ermöglichen zusammen mit Genome Editing Techniken wie CRISPR/Cas9 und TALEN (Transcription Activator-like Effector Nucleasen) ein effizientes und hochspezifisches Zell-Engineering und revolutionierten damit das gesamte Feld [16 ]. Das Klonen von Golden Gate basiert auf Restriktionsenzymen vom Typ IIs (die außerhalb ihrer Erkennungssequenz schneiden) und bietet wichtige Vorteile: Es erfordert keine lange flankierende DNA, verwendet effiziente Eintopfreaktionen, ermöglicht ein narbenfreies Klonen und ist kostengünstig. Einsparung im Vergleich zu vielen anderen fortgeschrittenen Techniken [17]. In der Golden Gate Assembly (GGA) werden die beiden unterschiedlichen Restriktionsendonukleasen vom Typ IIs BsaIch und BpiI verwendet, die außerhalb ihrer Erkennungssequenz vier Basenpaarüberhänge ergeben. Diese Überhänge können frei gestaltet werden und werden als Fusionsstellen (Fs) bezeichnet. Diese Fusionsstellen ermöglichen den Basenpaar-genauen Zusammenbau genetischer Teile wie Promotoren, kodierende Sequenzen (CDS) und Transkriptionsterminatoren. Durch gleichzeitige Restriktion und Ligation in effizienten Eintopf-Klonierungsreaktionen wird ein schneller Zusammenbau mehrerer DNA-Fragmente erreicht [17].

Kürzlich haben Obst et al. [18] und Schreiber et al. [19] berichteten über die Verwendung der Golden Gate-Klonierung zur Generierung von Bibliotheken von Expressionskassetten in P. pastoris, die auf schnelle und effiziente Weise auf die Produktion von Reporterproteinen durch den Zusammenbau von standardisierten Teilen wie Promotoren, Ribosomenbindungsstellen, Sekretionssignalen und Terminatoren getestet wurden. Diese Studien zielten darauf ab, eine einzelne Transkriptionseinheit für die Produktion eines heterologen Proteins von Interesse (entweder eines fluoreszierenden Reporters oder eines antimikrobiellen Peptids) zu optimieren. Voglet al. [20] verwendeten Gibson-Assembly mit einer Reihe von MUT-verwandten Promotoren und neuartigen Transkriptionsterminatoren für die Überexpression mehrerer Gene in P. pastoris und konnte eine starke Wirkung der inserierten Promotoren bei Überexpression des Carotinoidweges (crtE, crtB, crtI und crtY) zeigen. Unsere Studie erweitert die vielseitige Golden Gate Technik für alle Anwendungen in P. pastoris wo die gleichzeitige Integration mehrerer DNA-Produkte erforderlich ist (z. B. Zell-Engineering, Pathway-Expression, Proteinproduktion, Co-Expression von Cofaktoren) und zielt über den bloßen Zusammenbau einzelner Expressionskassetten für das interessierende heterologe Protein hinaus.

Dazu haben wir das von Weber et al. eingeführte Golden Gate-basierte modulare Klonen (MoClo) adaptiert. [21], um das Goldene zu erschaffenPiCS (Golden Gate abgeleitet P. pastoris Klonsystem) Vektor-Toolkit. GoldenPiCS ist Teil eines universellen Systems namens GoldenMOCS, das für Golden Gate-derived Multiple Organism Cloning System steht [22]. Die GoldenMOCS-Plattform ermöglicht eine vielseitige Integration von wirtsspezifischen Teilen wie Promotoren, Terminatoren und Resistenzkassetten, Replikationsursprüngen oder Genomintegrations-Loci, um das Plasmid an die Bedürfnisse des Experiments und der zu entwickelnden Wirtszelle anzupassen. Hier präsentieren wir das GoldenMOCS- Subsystem GoldenPiCS für den Einsatz in P. pastoris und die Charakterisierung seiner einzelnen genetischen Teile unter Verwendung von eGFP (Enhanced Green Fluorescence Protein) als Reporter. Vektoren dieser Systeme wurden bei Addgene als Golden . hinterlegtPiCS-Kit (#1000000133).


Wir berichten über das Design, die Synthese und den Aufbau des 1.08-Mega-Basenpaares Mykoplasmen-Mykoide JCVI-syn1.0-Genom ausgehend von digitalisierten Genomsequenzinformationen und deren Transplantation in a M. Capricolum Empfängerzelle neu erstellen M. mycoides Zellen, die nur vom synthetischen Chromosom kontrolliert werden. Die einzige DNA in den Zellen ist die entworfene synthetische DNA-Sequenz, einschließlich „Wasserzeichen“-Sequenzen und anderer entworfener Gendeletionen und Polymorphismen sowie während des Bauprozesses erworbener Mutationen. Die neuen Zellen haben erwartete phänotypische Eigenschaften und sind zur kontinuierlichen Selbstreplikation fähig.

1977 bestimmten Sanger und Kollegen die vollständige genetische Sequenz des Phagen ϕX174 (1), das erste vollständig sequenzierte DNA-Genom. Achtzehn Jahre später, 1995, konnte unser Team die erste vollständige genetische Sequenz eines sich selbst replizierenden Bakteriums lesen, Haemophilus influenzae (2). Das Ablesen der genetischen Sequenz einer Vielzahl von Arten hat seit diesen frühen Studien exponentiell zugenommen. Die Fähigkeit, genomische Informationen schnell zu digitalisieren, hat in den letzten 25 Jahren um mehr als acht Größenordnungen zugenommen (3). Die Bemühungen, all diese neuen genomischen Informationen zu verstehen, haben zahlreiche neue rechnerische und experimentelle Paradigmen hervorgebracht, doch unser genomisches Wissen bleibt sehr begrenzt. Kein einzelnes zelluläres System hat alle seine Gene in Bezug auf ihre biologischen Rollen verstanden. Enthalten die Chromosomen selbst in einfachen Bakterienzellen das gesamte genetische Repertoire? Wenn ja, kann ein vollständiges genetisches System durch chemische Synthese reproduziert werden, indem nur die digitalisierte DNA-Sequenz in einem Computer verwendet wird?

Unser Interesse an der Synthese großer DNA-Moleküle und Chromosomen entstand aus unseren Bemühungen in den letzten 15 Jahren, eine minimale Zelle aufzubauen, die nur essentielle Gene enthält. Diese Arbeit wurde 1995 eingeweiht, als wir das Genom von Mycoplasma genitalium, ein Bakterium mit dem kleinsten Genkomplement aller bekannten Organismen, das im Labor unabhängig wachsen kann. Mehr als 100 der 485 proteinkodierenden Gene von M. genitalium sind entbehrlich, wenn sie nacheinander unterbrochen werden (46).

Wir entwickelten eine Strategie für den Zusammenbau viraler Teile, um große DNA-Moleküle herzustellen, die es uns ermöglichten, ein synthetisches M. genitalium Genom in vier Stufen aus chemisch synthetisierten DNA-Kassetten mit einer durchschnittlichen Größe von etwa 6 kb. Dies wurde durch eine Kombination aus enzymatischen In-vitro-Methoden und In-vivo-Rekombination in erreicht Saccharomyces cerevisiae. Das gesamte synthetische Genom [582.970 Basenpaare (bp)] wurde stabil als zentromerisches Hefeplasmid (YCp) gezüchtet (7).

Bei der Transplantation und Expression eines chemisch synthetisierten Chromosoms in eine Empfängerzelle wurden mehrere Hürden genommen. Wir mussten die Methoden zur Extraktion intakter Chromosomen aus Hefe verbessern. Wir mussten auch lernen, wie man diese Genome in eine Empfänger-Bakterienzelle transplantiert, um eine Zelle zu etablieren, die nur von einem synthetischen Genom kontrolliert wird. Weil M. genitalium eine extrem langsame Wachstumsrate hat, wandten wir uns zwei schneller wachsenden Mykoplasmenarten zu, M. mycoides Unterart Capri (GM12) als Spender und M. Capricolum Unterart Capricolum (CK) als Empfänger.

Um Bedingungen und Verfahren für die Transplantation des synthetischen Genoms aus Hefe zu schaffen, entwickelten wir Methoden zum Klonen ganzer Bakterienchromosomen als zentromere Plasmide in Hefe, einschließlich eines nativen M. mycoides Genom (8, 9). Erste Versuche, die M. mycoides Genom aus Hefe und transplantiere es in M. Capricolum gescheitert. Wir entdeckten, dass Spender- und Empfängermykoplasmen ein gemeinsames Restriktionssystem haben. Das Spendergenom wurde im nativen methyliert M. mycoides Zellen und war daher während der Transplantation aus einer nativen Spenderzelle vor Restriktion geschützt (10). Die in Hefe gezüchteten Bakteriengenome sind jedoch unmethyliert und daher nicht vor dem einzigen Restriktionssystem der Empfängerzelle geschützt. Wir haben diese Restriktionsbarriere überwunden, indem wir die Donor-DNA mit gereinigten Methylasen oder rohem methyliert haben M. mycoides oder M. Capricolum Extrakte oder durch einfaches Unterbrechen des Restriktionssystems der Empfängerzelle (8).

Wir haben nun alle unsere bisher etablierten Verfahren kombiniert und berichten über die Synthese, den Aufbau, das Klonen und die erfolgreiche Transplantation des 1,08-Mbp M. mycoides JCVI-syn1.0-Genom, um eine neue Zelle zu schaffen, die von diesem synthetischen Genom kontrolliert wird.

Synthetisches Genomdesign. Gestaltung des M. mycoides Das JCVI-syn1.0-Genom basierte auf den hochpräzisen fertigen Genomsequenzen von zwei Laborstämmen von M. mycoides Unterart Capri GM12 (8, 9, 11). Einer war der von Lartigue . verwendete Genomspender et al. [GenBank-Beitritt CP001621] (10). Der andere war ein Stamm, der durch die Transplantation eines Genoms entstand, das in Hefe kloniert und gentechnisch verändert wurde, YCpMmyc1.1-ΔTypIIIres [GenBank-Beitritt CP001668] (8). Dieses Projekt war entscheidend von der Genauigkeit dieser Sequenzen abhängig. Obwohl wir glauben, dass beide fertig sind M. mycoides Genomsequenzen sind zuverlässig, es gibt 95 Stellen, an denen sie sich unterscheiden. Wir begannen mit dem Design des synthetischen Genoms, bevor beide Sequenzen fertig waren. Folglich wurden die meisten Kassetten basierend auf der CP001621-Sequenz entworfen und synthetisiert (11). Als es fertig war, wählten wir die Sequenz des erfolgreich aus Hefe transplantierten Genoms (CP001668) als Designreferenz (außer dass wir die intakte TypIIIres Gen). Alle Unterschiede, die zwischen CP001668 und zuvor synthetisierten Kassetten biologisch signifikant erschienen, wurden so korrigiert, dass sie genau damit übereinstimmen (11). Sequenzunterschiede zwischen unseren synthetischen Kassetten und CP001668, die an 19 Stellen auftraten, erschienen harmlos und wurden daher nicht korrigiert. Diese bieten 19 polymorphe Unterschiede zwischen unserem synthetischen Genom (JCVI-syn1.0) und dem natürlichen (nicht-synthetischen) Genom (YCpMmyc1.1), das wir in Hefe kloniert haben und als Standard für die Genomtransplantation aus Hefe verwenden (8). Um weiter zwischen dem synthetischen Genom und dem natürlichen zu unterscheiden, haben wir vier Wasserzeichensequenzen (Abb. S1) entworfen, um eine oder mehrere Kassetten in experimentell nachgewiesenen [Wasserzeichen 1 (1246 bp) und 2 (1081 bp)] oder vorhergesagten [Wasserzeichen 3 (1109 bp) und 4 (1222 bp)], um die Lebensfähigkeit der Zellen nicht zu beeinträchtigen. Diese Wasserzeichensequenzen codieren einzigartige Identifikatoren, während sie ihre Übersetzung in Peptide begrenzen. Tabelle S1 listet die Unterschiede zwischen dem synthetischen Genom und diesem natürlichen Standard auf. Abbildung S2 zeigt eine Karte der M. mycoides JCVI-syn1.0-Genom. Kassetten- und Montagezwischengrenzen, Wasserzeichen, Deletionen, Einfügungen und Gene des M. mycoides JCVI syn1.0 sind in Abb. 1 dargestellt. S2, und die Sequenz des transplantierten Mycoplasma-Klons sMmYCp235-1 wurde bei GenBank eingereicht (Zugang CP002027).

Synthetische Genom-Assembly-Strategie. Die entworfenen Kassetten waren im Allgemeinen 1080 bp mit 80-bp-Überlappungen zu benachbarten Kassetten (11). Sie wurden alle durch Zusammenbau chemisch synthetisierter Oligonukleotide von Blue Heron (Bothell, Washington) hergestellt. Jede Kassette wurde einzeln synthetisiert und vom Hersteller sequenzverifiziert. Um den Bauprozess zu unterstützen, wurden DNA-Kassetten und Assemblierungs-Zwischenprodukte so entworfen, dass sie Not I-Restriktionsstellen an ihren Enden enthalten und in Gegenwart von Vektorelementen rekombiniert wurden, um Wachstum und Selektion in Hefe zu ermöglichen (7, 11). Eine hierarchische Strategie wurde entwickelt, um das Genom in drei Stufen durch Transformation und homologe Rekombination in Hefe aus 1078 1-kb-Kassetten aufzubauen (Abb. 1) (12, 13).

Der Zusammenbau eines synthetischen M. mycoides Genom in Hefe. Ein synthetisches M. mycoides Genom wurde aus 1078 überlappenden DNA-Kassetten in drei Schritten zusammengesetzt. Im ersten Schritt wurden 1080-bp-Kassetten (orange Pfeile), die aus überlappenden synthetischen Oligonukleotiden hergestellt wurden, in Sätzen von 10 rekombiniert, um 109 . zu produzieren

10-kb-Assemblys (blaue Pfeile). Diese wurden dann in Sätzen von 10 rekombiniert, um 11 . zu erzeugen

100-kb-Assemblys (grüne Pfeile). In der letzten Phase des Zusammenbaus wurden diese 11 Fragmente zum vollständigen Genom (roter Kreis) rekombiniert. Mit Ausnahme von zwei Konstrukten, die in vitro enzymatisch zusammengesetzt wurden (27) (weiße Pfeile) wurden Assemblierungen durch homologe In-vivo-Rekombination in Hefe durchgeführt. Wesentliche Abweichungen vom natürlichen Genom werden als gelbe Kreise dargestellt. Dazu gehören vier mit Wasserzeichen versehene Regionen (WM1 bis WM4), eine 4 kb-Region, die absichtlich deletiert wurde (94D) und Elemente für das Wachstum bei Hefe- und Genomtransplantation. Darüber hinaus gibt es 20 Stellen mit Nukleotidpolymorphismen (Sternchen). Die Koordinaten des Genoms sind relativ zum ersten Nukleotid des natürlichen M. mycoides Reihenfolge. Die entworfene Sequenz ist 1.077.947 bp lang. Die Orte der Asc I- und BssH II-Restriktionsstellen sind gezeigt. Kassetten 1 und 800-810 waren unnötig und wurden aus der Bestückungsstrategie entfernt (11). Kassette 2 überlappt Kassette 1104 und Kassette 799 überlappt Kassette 811.

Zusammenbau von 10-kb-synthetischen Zwischenprodukten. In der ersten Stufe wurden Kassetten und ein Vektor in Hefe rekombiniert und auf Escherichia coli (11). Plasmid-DNA wurde dann aus Individuen isoliert E coli Klone und verdaut, um nach Zellen zu screenen, die einen Vektor mit einem zusammengesetzten 10-kb-Insert enthalten. Eine erfolgreiche 10-kb-Assembly ist dargestellt (Fig. 2A). Im Allgemeinen könnte mindestens ein zusammengesetztes 10-kb-Fragment durch Screening von 10 Hefeklonen erhalten werden. Die Erfolgsrate schwankte jedoch zwischen 10 und 100 %. Alle Zwischenprodukte der ersten Stufe wurden sequenziert. Neunzehn von 111 Baugruppen enthielten Fehler. Alternative Klone wurden ausgewählt, sequenzverifiziert und zur nächsten Montagestufe (11).

Analyse der Montagezwischenprodukte. (EIN) Not I- und Sbf I-Doppel-Restriktionsverdau-Analyse der Anordnung 341-350, gereinigt aus E coli. Diese Restriktionsenzyme setzen die Vektorfragmente (5,5 und 3,4 kb) aus dem 10-kb-Insert frei. Die Insert-DNA wurde auf einem 0,8% E-Gel (Invitrogen) von der Vektor-DNA getrennt. M bezeichnet die 1-kb-DNA-Leiter (New England Biolabs NEB). (B) Analyse der Anordnung 501-600, gereinigt aus Hefe. Die 105-kb-Kreise (100-kb-Insert plus 5-kb-Vektor) wurden von der linearen chromosomalen Hefe-DNA auf einem 1% Agarosegel durch Anlegen von 4,5 V/cm für 3 Stunden getrennt. S bezeichnet die Supercoiled-DNA-Leiter des BAC-Tracker (Epizentrum). (C) Nicht I Restriktionsverdau-Analyse der 11

100-kb-Assemblies, gereinigt aus Hefe. Diese DNA-Fragmente wurden durch FIGE auf einem 1% Agarosegel analysiert. Die erwartete Einsatzgröße für jede Baugruppe wird angezeigt. λ bezeichnet die Lambda-Leiter (NEB). (D) Analyse der 11 gepoolten Anordnungen, die in (C) gezeigt sind, nach topologischem Einfangen der zirkulären DNA und NotI-Verdau. Ein Vierzigstel der zur Hefetransformation verwendeten DNA ist vertreten.

Zusammenbau von 100-kb-synthetischen Zwischenprodukten. Die gepoolten 10-kb-Assemblies und ihre jeweiligen Klonierungsvektoren wurden wie oben in Hefe transformiert, um 100-kb-Assembly-Zwischenprodukte herzustellen (11). Unsere Ergebnisse zeigten, dass diese Produkte nicht stabil in E coli, also musste rekombinierte DNA aus Hefe extrahiert werden. An ausgewählten Hefeklonen wurde eine Multiplex-Polymerase-Kettenreaktion (PCR) durchgeführt (Abb. S3 und Tabelle S2). Da jedes 10-kb-Assembly-Zwischenprodukt in dieser Analyse durch ein Primerpaar repräsentiert wurde, würde die Anwesenheit aller Amplikons ein assembliertes 100-kb-Intermediat nahelegen. Im Allgemeinen enthielten 25 % oder mehr der gescreenten Klone alle Amplikons, die für eine vollständige Anordnung erwartet werden. Einer dieser Klone wurde für ein weiteres Screening ausgewählt. Die zirkuläre Plasmid-DNA wurde extrahiert und auf einem Agarosegel neben einem Supercoiled-Marker nach Größe sortiert. Erfolgreiche Montagen der zweiten Stufe mit der Vektorsequenz sind

105 kb lang (Abb. 2B). Wenn alle Amplikons im Anschluss an eine Multiplex-PCR hergestellt wurden, wurde normalerweise ein Zusammenbau-Zwischenprodukt der zweiten Stufe der richtigen Größe hergestellt. In einigen Fällen traten jedoch kleine Deletionen auf. In anderen Fällen wurden mehrere 10-kb-Fragmente zusammengebaut, was ein größeres Zusammenbau-Zwischenprodukt der zweiten Stufe erzeugte. Glücklicherweise konnten diese Unterschiede leicht auf einem Agarosegel vor der vollständigen Genommontage nachgewiesen werden.

Komplette Genommontage. In Vorbereitung auf die letzte Montagephase war es notwendig, Mikrogramm-Mengen von jeder der 11 Baugruppen der zweiten Stufe zu isolieren (11). Wie berichtet (14). Um die 11 Assemblierungs-Zwischenprodukte weiter zu reinigen, wurden sie mit Exonuklease behandelt und durch eine Anionenaustauschersäule geleitet. Eine kleine Fraktion der gesamten Plasmid-DNA (1/100) wurde mit NotI verdaut und durch Feld-Inversions-Gelelektrophorese (Fig. 2C) analysiert. Diese Methode produziert

1 µg jeder Baugruppe pro 400 ml Hefekultur (

The method above does not completely remove all of the linear yeast chromosomal DNA, which we found could substantially decrease the yeast transformation and assembly efficiency. To further enrich for the 11 circular assembly intermediates,

200 ng samples of each assembly were pooled and mixed with molten agarose. As the agarose solidifies, the fibers thread through and topologically “trap” circular DNA (15). Untrapped linear DNA can then be separated out of the agarose plug by electrophoresis, thus enriching for the trapped circular molecules. The 11 circular assembly intermediates were digested with Not I so that the inserts could be released. Subsequently, the fragments were extracted from the agarose plug, analyzed by FIGE (Fig. 2D), and transformed into yeast spheroplasts (11). In this third and final stage of assembly, an additional vector sequence was not required because the yeast cloning elements were already present in assembly 811-900.

To screen for a complete genome, multiplex PCR was carried out with 11 primer pairs, designed to span each of the 11 100-kb assembly junctions (table S3). Of 48 colonies screened, DNA extracted from one clone (sMmYCp235) produced all 11 amplicons. PCR of the wild-type positive control (YCpMmyc1.1) produced an indistinguishable set of 11 amplicons (Fig. 3A). To further demonstrate the complete assembly of a synthetic M. mycoides genome, intact DNA was isolated from yeast in agarose plugs and subjected to two restriction analyses: Asc I and BssH II (11). Because these restriction sites are present in three of the four watermark sequences, this choice of digestion produces restriction patterns that are distinct from that of the natural M. mycoides genome (Figs. 1 and 3B). The sMmYCp235 clone produced the restriction pattern expected for a completely assembled synthetic genome (Fig. 3C).

Characterization of the synthetic genome isolated from yeast. (EIN) Yeast clones containing a completely assembled synthetic genome were screened by multiplex PCR with a primer set that produces 11 amplicons one at each of the 11 assembly junctions. Yeast clone sMmYCp235 (235) produced the 11 PCR products expected for a complete genome assembly. For comparison, the natural genome extracted from yeast (WT, wild type) was also analyzed. PCR products were separated on a 2% E-gel (Invitrogen). L indicates the 100-bp ladder (NEB). (B) The sizes of the expected Asc I and BssH II restriction fragments for natural (WT) and synthetic (Syn235) M. mycoides genomes. (C) Natural (WT) and synthetic (235) M. mycoides genomes were isolated from yeast in agarose plugs. In addition, DNA was purified from the host strain alone (H). Agarose plugs were digested with Asc I or BssH II, and fragments were separated by clamped homogeneous electrical field (CHEF) gel electrophoresis. Restriction fragments corresponding to the correct sizes are indicated by the fragment numbers shown in (B).

Synthetic genome transplantation. Additional agarose plugs used in the gel analysis above (Fig. 3C) were also used in genome transplantation experiments (11). Intact synthetic M. mycoides genomes from the sMmYCp235 yeast clone were transplanted into restriction-minus M. capricolum recipient cells, as described (8). Results were scored by selecting for growth of blue colonies on SP4 medium containing tetracycline and X-gal at 37°C. Genomes isolated from this yeast clone produced 5 to 15 tetracycline-resistant blue colonies per agarose plug, a number comparable to that produced by the YCpMmyc1.1 control. Recovery of colonies in all transplantation experiments was dependent on the presence of both M. capricolum recipient cells and an M. mycoides Genom.

Semisynthetic genome assembly and transplantation. To aid in testing the functionality of each 100-kb synthetic segment, semisynthetic genomes were constructed and transplanted. By mixing natural pieces with synthetic ones, the successful construction of each synthetic 100-kb assembly could be verified without having to sequence these intermediates. We cloned 11 overlapping natural 100-kb assemblies in yeast by using a previously described method (16). In 11 parallel reactions, yeast cells were cotransformed with fragmented M. mycoides genomic DNA (YCpMmyc 1.1) that averaged

100 kb in length and a PCR-amplified vector designed to overlap the ends of the 100-kb inserts. To maintain the appropriate overlaps so that natural and synthetic fragments could be recombined, the PCR-amplified vectors were produced via primers with the same 40-bp overlaps used to clone the 100-kb synthetic assemblies. The semisynthetic genomes that were constructed contained between 2 and 10 of the 11 100-kb synthetic subassemblies (Table 1). The production of viable colonies produced after transplantation confirmed that the synthetic fraction of each genome contained no lethal mutations. Only one of the 100-kb subassemblies, 811-900, was not viable.

Genomes that have been assembled from 11 pieces and successfully transplanted. Assembly 2-100, 1 assembly 101-200, 2 assembly 201-300, 3 assembly 301-400, 4 assembly 401-500, 5 assembly 501-600, 6 assembly 601-700, 7 assembly 701-799, 8 assembly 811-900, 9 assembly 901-1000, 10 assembly 1001-1104, 11. WM, watermarked assembly.

Initially, an error-containing 811-820 clone was used to produce a synthetic genome that did not transplant. This was expected because the error was a single–base pair deletion that creates a frameshift in dnaA, an essential gene for chromosomal replication. We were previously unaware of this mutation. By using a semisynthetic genome construction strategy, we pinpointed 811-900 as the source for failed synthetic transplantation experiments. Thus, we began to reassemble an error-free 811-900 assembly, which was used to produce the sMmYCp235 yeast strain. Die dnaA-mutated genome differs by only one nucleotide from the synthetic genome in sMmYCp235. This genome served as a negative control in our transplantation experiments. Die dnaA mutation was also repaired at the 811-900 level by genome engineering in yeast (17). A repaired 811-900 assembly was used in a final-stage assembly to produce a yeast clone with a repaired genome. This yeast clone is named sMmYCP142 and could be transplanted. A complete list of genomes that have been assembled from 11 pieces and successfully transplanted is provided in Table 1.

Characterization of the synthetic transplants. To rapidly distinguish the synthetic transplants from M. capricolum or natural M. mycoides, two analyses were performed. First, four primer pairs that are specific to each of the four watermarks were designed such that they produce four amplicons in a single multiplex PCR reaction (table S4). All four amplicons were produced by transplants generated from sMmYCp235, but not YCpMmyc1.1 (Fig. 4A). Second, the gel analysis with Asc I and BssH II, described above (Fig. 3C), was performed. The restriction pattern obtained was consistent with a transplant produced from a synthetic M. mycoides genome (Fig. 4B).

Characterization of the transplants. (EIN) Transplants containing a synthetic genome were screened by multiplex PCR with a primer set that produces four amplicons, one internal to each of the four watermarks. One transplant (syn1.0) originating from yeast clone sMmYCp235 was analyzed alongside a natural, nonsynthetic genome (WT) transplanted out of yeast. The transplant containing the synthetic genome produced the four PCR products, whereas the WT genome did not produce any. PCR products were separated on a 2% E-gel (Invitrogen). (B) Natural (WT) and synthetic (syn1.0) M. mycoides genomes were isolated from M. mycoides transplants in agarose plugs. Agarose plugs were digested with Asc I or BssH II and fragments were separated by CHEF gel electrophoresis. Restriction fragments corresponding to the correct sizes are indicated by the fragment numbers shown in Fig. 3B.

A single transplant originating from the sMmYCp235 synthetic genome was sequenced. We refer to this strain as M. mycoides JCVI-syn1.0. The sequence matched the intended design with the exception of the known polymorphisms, eight new single-nucleotide polymorphisms, an E coli transposon insertion, and an 85-bp duplication (table S1). The transposon insertion exactly matches the size and sequence of IS1, a transposon in E coli. It is likely that IS1 infected the 10-kb subassembly following its transfer to E coli. The IS1 insert is flanked by direct repeats of M. mycoides sequence, suggesting that it was inserted by a transposition mechanism. The 85-bp duplication is a result of a nonhomologous end joining event, which was not detected in our sequence analysis at the 10-kb stage. These two insertions disrupt two genes that are evidently nonessential. We did not find any sequences in the synthetic genome that could be identified as belonging to M. capricolum. This indicates that there was a complete replacement of the M. capricolum genome by our synthetic genome during the transplant process.

The cells with only the synthetic genome are self-replicating and capable of logarithmic growth. Scanning and transmission electron micrographs (EMs) of M. mycoides JCVI-syn1.0 cells show small, ovoid cells surrounded by cytoplasmic membranes (Fig. 5, C to F). Proteomic analysis of M. mycoides JCVI-syn1.0 and the wild-type control (YCpMmyc1.1) by two-dimensional gel electrophoresis revealed almost identical patterns of protein spots (fig. S4) that differed from those previously reported for M. capricolum (10). Fourteen genes are deleted or disrupted in the M. mycoides JCVI-syn1.0 genome however, the rate of appearance of colonies on agar plates and the colony morphology are similar (compare Fig. 5, A and B). We did observe slight differences in the growth rates in a color-changing unit assay, with the JCVI-syn1.0 transplants growing slightly faster than the MmcyYCp1.1 control strain (fig. S6).

Images of M. mycoides JCVI-syn1.0 and WT M. mycoides. To compare the phenotype of the JCVI-syn1.0 and non-YCp WT strains, we examined colony morphology by plating cells on SP4 agar plates containing X-gal. Three days after plating, the JCVI-syn1.0 colonies are blue because the cells contain the lacZ gene and express β-galactosidase, which converts the X-gal to a blue compound (EIN). The WT cells do not contain lacZ and remain white (B). Both cell types have the fried egg colony morphology characteristic of most mycoplasmas. EMs were made of the JCVI-syn1.0 isolate using two methods. (C) For scanning EM, samples were postfixed in osmium tetroxide, dehydrated and critical point dried with CO2, and visualized with a Hitachi SU6600 SEM at 2.0 keV. (D) Negatively stained transmission EMs of dividing cells with 1% uranyl acetate on pure carbon substrate visualized using JEOL 1200EX CTEM at 80 keV. To examine cell morphology, we compared uranyl acetate–stained EMs of M. mycoides JCVI-syn1.0 cells (E) with EMs of WT cells made in 2006 that were stained with ammonium molybdate (F). Both cell types show the same ovoid morphology and general appearance. EMs were provided by T. Deerinck and M. Ellisman of the National Center for Microscopy and Imaging Research at the University of California at San Diego.

Discussion. In 1995, the quality standard for sequencing was considered to be one error in 10,000 bp, and the sequencing of a microbial genome required months. Today, the accuracy is substantially higher. Genome coverage of 30 to 50× is not unusual, and sequencing only requires a few days. However, obtaining an error-free genome that could be transplanted into a recipient cell to create a new cell controlled only by the synthetic genome was complicated and required many quality-control steps. Our success was thwarted for many weeks by a single–base pair deletion in the essential gene dnaA. One wrong base out of more than 1 million in an essential gene rendered the genome inactive, whereas major genome insertions and deletions in nonessential parts of the genome had no observable effect on viability. The demonstration that our synthetic genome gives rise to transplants with the characteristics of M. mycoides cells implies that the DNA sequence on which it is based is accurate enough to specify a living cell with the appropriate properties.

Our synthetic genomic approach stands in sharp contrast to various other approaches to genome engineering that modify natural genomes by introducing multiple insertions, substitutions, or deletions (1822). This work provides a proof of principle for producing cells based on computer-designed genome sequences. DNA sequencing of a cellular genome allows storage of the genetic instructions for life as a digital file. The synthetic genome described here has only limited modifications from the naturally occurring M. mycoides Genom. However, the approach we have developed should be applicable to the synthesis and transplantation of more novel genomes as genome design progresses (23).

We refer to such a cell controlled by a genome assembled from chemically synthesized pieces of DNA as a “synthetic cell,” even though the cytoplasm of the recipient cell is not synthetic. Phenotypic effects of the recipient cytoplasm are diluted with protein turnover and as cells carrying only the transplanted genome replicate. Following transplantation and replication on a plate to form a colony (>30 divisions or >10 9 -fold dilution), progeny will not contain any protein molecules that were present in the original recipient cell (10, 24). This was previously demonstrated when we first described genome transplantation (10). The properties of the cells controlled by the assembled genome are expected to be the same as if the whole cell had been produced synthetically (the DNA software builds its own hardware).

The ability to produce synthetic cells renders it essential for researchers making synthetic DNA constructs and cells to clearly watermark their work to distinguish it from naturally occurring DNA and cells. We have watermarked the synthetic chromosome in this and our previous study (7).

If the methods described here can be generalized, design, synthesis, assembly, and transplantation of synthetic chromosomes will no longer be a barrier to the progress of synthetic biology. We expect that the cost of DNA synthesis will follow what has happened with DNA sequencing and continue to exponentially decrease. Lower synthesis costs combined with automation will enable broad applications for synthetic genomics.

We have been driving the ethical discussion concerning synthetic life from the earliest stages of this work (25, 26). As synthetic genomic applications expand, we anticipate that this work will continue to raise philosophical issues that have broad societal and ethical implications. We encourage the continued discourse.