Information

Telomer-Elongationsmethoden?


Welche Arten von Telomerverlängerungsmethoden gibt es derzeit?

Würde das aufhören zu altern? (Bearbeiten: Nein, wahrscheinlich)

Bei Google konnte ich nichts gutes finden. Ich dachte, dass Sie vielleicht die Telomere sequenzieren, sie alle an einem bestimmten Punkt trimmen und dann ein Polymerase-Molekül so konstruieren könnten, dass es sich von diesem Punkt aus erstreckt. Wird das so gemacht?


Es wäre einfacher, Telomerase-Gene einfach zu aktivieren oder sie mit einem Vektorvirus einzufügen. Telomerase ist jedoch eine Schlüsselkomponente im Prozess der Tumortransformation. Grundsätzlich, wenn Sie Zellen nicht sterben lassen, werden sie Mutationen stapeln, bis sie tumorös werden.


Ein statistischer Ansatz zur Unterscheidung der Telomer-Elongation von Fehlern in Längsschnittdatensätzen

Die Länge der Telomere und die Rate des Telomerabriebs variieren von Person zu Person und wurden als die Rate interpretiert, mit der Personen altern. Die Biologie der Telomere schreibt eine Verkürzung mit dem Alter vor, obwohl eine Telomerverlängerung mit dem Alter wiederholt bei einer Minderheit von Individuen in mehreren Populationen beobachtet wurde. Diese Ergebnisse wurden eher auf Fehler als auf die tatsächliche Telomerverlängerung zurückgeführt, was unser Verständnis ihrer möglichen biologischen Bedeutung einschränkt. Hier präsentieren wir eine Methode zur Unterscheidung zwischen Fehler und Telomerverlängerung in Längsschnittdatensätzen, die einfach anzuwenden ist und nur wenige Annahmen hat. Anhand von Simulationen zeigen wir, dass die Methode eine beträchtliche statistische Aussagekraft (>80 %) besitzt, um auch nur einen geringen Anteil (6,7 %) der TL-Zunahmen in der Bevölkerung innerhalb einer relativ kleinen Stichprobe zu erkennen (n = 200) unter Beibehaltung des Standardniveaus der Fehlerquote Typ I (α ≤ 0,05).

Dies ist eine Vorschau von Abonnementinhalten, auf die Sie über Ihre Institution zugreifen können.


Keimbahnmutationen des Regulators der Telomer-Elongations-Helikase 1, RTEL1, bei angeborener Dyskeratose

Dyskeratosis congenita (DC) ist ein erbliches Knochenmarkversagen und ein Krebsprädispositionssyndrom, das durch eine abweichende Telomerbiologie verursacht wird. Die klassische Trias von dysplastischen Nägeln, abnormaler Hautpigmentierung und oraler Leukoplakie ist diagnostisch für DC, aber es besteht eine erhebliche klinische Heterogenität. Keimbahnmutationen in Telomerbiologie-Genen machen etwa die Hälfte der bekannten DC-Familien aus. Mittels Exom-Sequenzierung identifizierten wir Mutationen in RTEL1, eine Helikase mit kritischen Telomerfunktionen, in zwei Familien mit HH. In der ersten Familie erbten zwei Geschwister mit HH und sehr kurzen Telomeren ein vorzeitiges Stoppcodon von ihrer Mutter mit kurzen Telomeren. Der Proband aus der zweiten Familie hat HH und hat ein vorzeitiges Stoppcodon in . geerbt RTEL1 von seinem Vater und eine Missense-Mutation von seiner Mutter, die ebenfalls kurze Telomere hat. Darüber hinaus führte die Vererbung nur der Missense-Mutation zu sehr kurzen Telomeren beim Bruder des Probanden. Gezielte Sequenzierung identifizierte einen anderen RTEL1 Missense-Mutation bei einem weiteren DC-Probanden mit Knochenmarkversagen und kurzen Telomeren. Beide Missense-Mutationen beeinflussen die Helikase-Domäne von RTEL1, und drei In-silico-Vorhersagealgorithmen legen nahe, dass sie wahrscheinlich schädlich sind. Die Nonsense-Mutationen verursachen beide eine Verkürzung der RTEL1 Protein, was zum Verlust der PIP-Box führt, wodurch eine wichtige Protein-Protein-Interaktion aufgehoben werden kann. Diese Ergebnisse implizieren ein neues Telomerbiologie-Gen, RTEL1, in der Ätiologie von DC.

Dies ist eine Vorschau von Abonnementinhalten, auf die Sie über Ihre Institution zugreifen können.


Studienergebnisse: Telomerverlängerung dreht die Alterungsuhr in kultivierten menschlichen Zellen zurück

Die Forscher lieferten eine modifizierte RNA, die ein telomerverlängerndes Protein kodiert, an kultivierte menschliche Zellen. Die Zellproliferationskapazität wurde dramatisch erhöht, was eine große Anzahl von Zellen für die Untersuchung ergab.

Laut Wissenschaftlern der Stanford University School of Medicine kann ein neues Verfahren die Länge der menschlichen Telomere, der Schutzkappen an den Enden von Chromosomen, die mit Alterung und Krankheit in Verbindung gebracht werden, schnell und effizient verlängern.

Behandelte Zellen verhalten sich viel jünger als unbehandelte Zellen und vermehren sich in der Laborschale hingebungsvoll, anstatt zu stagnieren oder zu sterben.

Das Verfahren, bei dem ein modifizierter RNA-Typ verwendet wird, wird die Fähigkeit der Forscher verbessern, eine große Anzahl von Zellen für Studien oder die Entwicklung von Medikamenten zu erzeugen, sagen die Wissenschaftler. Hautzellen mit durch das Verfahren verlängerten Telomeren konnten sich bis zu 40 Mal mehr teilen als unbehandelte Zellen. Die Forschung könnte neue Wege zur Behandlung von Krankheiten aufzeigen, die durch verkürzte Telomere verursacht werden.

Telomere sind die Schutzkappen an den Enden der DNA-Stränge, die als Chromosomen bezeichnet werden und die unser Genom beherbergen. Bei jungen Menschen sind Telomere etwa 8.000-10.000 Nukleotide lang. Sie verkürzen sich jedoch mit jeder Zellteilung, und wenn sie eine kritische Länge erreichen, hört die Zelle auf, sich zu teilen oder stirbt. Diese interne „Uhr“ macht es schwierig, die meisten Zellen in einem Labor für mehr als ein paar Zellverdopplungen wachsen zu lassen.

„Die innere Uhr zurückdrehen“

„Jetzt haben wir einen Weg gefunden, menschliche Telomere um bis zu 1.000 Nukleotide zu verlängern und die innere Uhr dieser Zellen um das Äquivalent von vielen Jahren menschlichen Lebens zurückzudrehen“, sagte Helen Blau, PhD, Professorin für Mikrobiologie und Immunologie in Stanford und Direktor des Baxter Laboratory for Stem Cell Biology der Universität. „Dies erhöht die Zahl der Zellen, die für Studien wie Medikamententests oder Krankheitsmodellierung zur Verfügung stehen, erheblich.“

Ein Papier, das die Forschung beschreibt, wurde heute in der . veröffentlicht FASEB-Journal. Blau, der auch die Donald E. und Delia B. Baxter-Professur innehat, ist leitender Autor. Der Postdoktorand John Ramunas, PhD, aus Stanford teilt sich die Hauptautorenschaft mit Eduard Yakubov, PhD, vom Houston Methodist Research Institute.

Die Forscher nutzten modifizierte Boten-RNA, um die Telomere zu verlängern. RNA trägt Anweisungen von Genen in der DNA zu den Proteinfabriken der Zelle. Die in diesem Experiment verwendete RNA enthielt die kodierende Sequenz für TERT, die aktive Komponente eines natürlich vorkommenden Enzyms namens Telomerase. Telomerase wird von Stammzellen exprimiert, einschließlich solcher, aus denen Spermien und Eizellen hervorgehen, um sicherzustellen, dass die Telomere dieser Zellen für die nächste Generation in Topform bleiben. Die meisten anderen Zelltypen exprimieren jedoch sehr niedrige Telomerase-Spiegel.

Transienter Effekt von Vorteil

Die neu entwickelte Technik hat gegenüber anderen potentiellen Methoden einen wichtigen Vorteil: Sie ist temporär. Die modifizierte RNA soll die Immunantwort der Zelle auf die Behandlung reduzieren und es der TERT-kodierenden Nachricht ermöglichen, etwas länger zu bleiben als eine unmodifizierte Nachricht. Aber es verflüchtigt sich und ist innerhalb von etwa 48 Stunden verschwunden. Nach dieser Zeit beginnen sich die neu verlängerten Telomere mit jeder Zellteilung fortschreitend wieder zu verkürzen.

Der vorübergehende Effekt ist so etwas wie das Antippen des Gaspedals in einem Fahrzeug einer Flotte, das langsam zum Stillstand kommt. Das Auto mit dem zusätzlichen Energieschub wird weiter kommen als seine Konkurrenten, aber es wird immer noch zum Stehen kommen, wenn sein Vorwärtsdrang verbraucht ist. Auf biologischer Ebene bedeutet dies, dass sich die behandelten Zellen nicht unbegrenzt teilen, was sie aufgrund des Krebsrisikos für eine mögliche Therapie beim Menschen zu gefährlich machen würde.

Die Forscher fanden heraus, dass bereits drei Anwendungen der modifizierten RNA über einen Zeitraum von wenigen Tagen die Länge der Telomere in kultivierten menschlichen Muskel- und Hautzellen signifikant erhöhen können. Eine 1.000-Nukleotid-Addition bedeutet eine Verlängerung der Telomere um mehr als 10 Prozent. Diese Zellen teilten sich in der Kulturschale viel häufiger als unbehandelte Zellen: etwa 28-mal mehr für die Hautzellen und etwa dreimal mehr für die Muskelzellen.

„Wir waren überrascht und erfreut, dass modifizierte TERT-mRNA funktionierte, denn TERT ist stark reguliert und muss an einen anderen Bestandteil der Telomerase binden“, sagt Ramunas. „Frühere Versuche, mRNA-kodierendes TERT zu liefern, verursachten eine Immunantwort gegen Telomerase, die schädlich sein könnte. Im Gegensatz dazu ist unsere Technik nichtimmunogen. Bestehende vorübergehende Methoden zur Verlängerung von Telomeren wirken langsam, während unsere Methode nur wenige Tage lang wirkt, um die Telomerverkürzung umzukehren, die über mehr als ein Jahrzehnt des normalen Alterns auftritt. Dies deutet darauf hin, dass eine Behandlung mit unserer Methode kurz und selten sein könnte.“

Mögliche Anwendungen für die Therapie

„Dieser neue Ansatz ebnet den Weg zur Vorbeugung oder Behandlung von Alterskrankheiten“, sagte Blau. „Es gibt auch hochgradig schwächende genetische Erkrankungen, die mit einer Telomerverkürzung verbunden sind und von einer solchen potenziellen Behandlung profitieren könnten.“

Blau und ihre Kollegen interessierten sich für Telomere, als frühere Arbeiten in ihrem Labor zeigten, dass die Muskelstammzellen von Jungen mit Duchenne-Muskeldystrophie viel kürzere Telomere aufweisen als die von Jungen ohne die Krankheit. Dieser Befund hat nicht nur Auswirkungen auf das Verständnis, wie die Zellen bei der Bildung neuer Muskeln funktionieren – oder nicht funktionieren –, sondern hilft auch, die begrenzte Fähigkeit zu erklären, betroffene Zellen im Labor zu Studienzwecken zu züchten.

Die Forscher testen ihre neue Technik nun auch an anderen Zelltypen.

„Diese Studie ist ein erster Schritt zur Entwicklung einer Telomerverlängerung, um Zelltherapien zu verbessern und möglicherweise Störungen des beschleunigten Alterns beim Menschen zu behandeln“, sagte John Cooke, MD, PhD. Cooke, ein Mitautor der Studie, war zuvor Professor für Herz-Kreislauf-Medizin in Stanford. Heute ist er Lehrstuhlinhaber für Herz-Kreislauf-Wissenschaften am Houston Methodist Research Institute.

„Wir arbeiten daran, mehr über die Unterschiede zwischen den Zelltypen zu verstehen und wie wir diese Unterschiede überwinden können, damit dieser Ansatz universeller einsetzbar ist“, sagte Blau, der auch Mitglied des Stanford Institute for Stem Cell Biology ist und Regenerative Medizin.

„Eines Tages könnte es möglich sein, bei einem Patienten mit Duchenne-Muskeldystrophie gezielt Muskelstammzellen anzugreifen, um ihre Telomere zu verlängern. Es gibt auch Auswirkungen auf die Behandlung von Alterskrankheiten wie Diabetes und Herzerkrankungen. Dies hat wirklich die Türen geöffnet, um alle möglichen Anwendungsmöglichkeiten dieser Therapie in Betracht zu ziehen.“

Andere Stanford-Co-Autoren des Papiers sind die Postdoktoranden Jennifer Brady, PhD, und Moritz Brandt, MD, Senior Research Scientist Stéphane Corbel, PhD Research Associate Colin Holbrook und Juan Santiago, PhD, Professor für Maschinenbau.

Die Arbeit wurde von den National Institutes of Health (Grants R01AR063963, U01HL100397, U01HL099997 und AG044815), dem Bundesministerium für Bildung und Forschung, Stanford Bio-X und der Baxter Foundation unterstützt.

Ramunas, Yakubov, Cooke und Blau sind Erfinder von Patenten für die Verwendung modifizierter RNA zur Telomerverlängerung.


ERGEBNISSE

Basierend auf unseren Ergebnissen, dass 9 von 19 ESCRT Gene sind innerhalb der Untergruppe der kurzen . signifikant angereichert tlm Mutanten (mit a P Wert von 8,84E�, Fisher’s exakter Test) ( Abb.ꀚ ), haben wir die gesamte ESCRT-Familie auf ihre Beteiligung an der Erhaltung der Telomerlänge untersucht. Dazu analysierten wir (i) Daten zur Protein-Protein-Interaktion (PPI) und (ii) untersuchten das Telomersystem im Kontext einzelner ESCRT Gen-Deletionen.

ESCRT Gene sind an der Erhaltung der Telomerlänge beteiligt. (A) Venn-Diagramm, das die Überlappung von darstellt ESCRT Gene und kurz tlm Mutanten, deren P value (P) wurde mit einem exakten Fisher’-Test berechnet. Die Setgrößen sind pro Set angegeben und die Gesamtzahl der Gene, die für diesen Test berücksichtigt wurden, wird als U (Referenzsetgröße) angegeben. (B) Ein transversales Protein ist definiert als ein Protein, das zwei andere Proteine ​​im Protein-Protein-Interaktionsnetzwerk verbindet. Um Protein C von A (oder umgekehrt) zu erreichen, muss Protein B durchquert werden. (C) Matrix der kürzesten Wegabstände, angegeben als Anzahl der durchquerten Proteine, zwischen Mitgliedern der ESCRT-Familie (Spalten) und zentralen Telomerproteinen (Zeilen). Die Shortest-Path-Untersuchung wurde mit dem igraph Bibliothek des Programms R. Boldface markiert Mitglieder der ESCRT-Familie, deren entsprechende Mutanten verkürzte Telomere aufwiesen.

Um einen Einblick in die Zusammenhänge von Telomer-verwandten Proteinen und der ESCRT-Familie zu erhalten, haben wir ein manuell kuratiertes Saccharomyces cerevisiae PPI-Netzwerk (5.592 Proteine ​​und 28.581 Interaktionen). Dieses Netzwerk bestand ausschließlich aus experimentell verifizierten binären PPIs, was es zu einer sehr zuverlässigen Interaktionsquelle macht (zusammengestellt analog zum humanen Interaktom in Chapple et al. [14]). Wir definierten einen Satz von zentralen Telomerproteinen (CTPs) (5, 6), bestehend aus allen Untereinheiten des CST- (Cdc13, Stn1 und Ten1)-Capping-Komplexes, des Ku-Komplexes (Yku70 und Yku80), des MRX-Komplexes (Mre11, Rad50 und Xrs2) und die Proteine ​​Rif1, Rif2, Rap1, Exo1, Est1, Est2, Tel1 und Mec1. Diese Proteine ​​sind Teil der grundlegenden Maschinerie, die an der Aufrechterhaltung der Telomerlänge beteiligt ist. Anschließend haben wir eine Shortest-Path-Analyse durchgeführt, bei der die Entfernungen zwischen ESCRT-Komponenten und CTPs innerhalb des PPI-Netzwerks gemessen wurden. Unsere Ergebnisse zeigten, dass die meisten ESCRT-Komponenten durch mindestens zwei dazwischenliegende (transversale) ( Abb.ꀛ ) Proteine ​​mit CTP-Mitgliedern ( Abb.ꀜ ) verbunden waren. Bemerkenswerterweise hatten jedoch sechs ESCRT-Faktoren einen Abstand von nur einem transversalen Protein zu einem zentralen Telomerprotein. Abbildung S1 im ergänzenden Material zeigt das induzierte Subnetzwerk für all diese PPIs (31 Proteine ​​und 64 Interaktionen). Interessanterweise bilden Cdc13 und der ESCRT-0-Komplex, insbesondere Vps27, ein dichtes Subnetzwerk, dessen transversale Proteine ​​allesamt Proteinkinasen sind (siehe Abb. S1, orange). Diese Analyse legt daher eine starke Assoziation von ESCRT-0 an das Telomersystem über Cdc13 nahe. Wir haben uns daher für die Nutzung entschieden VPS27 für eine weitere eingehende Untersuchung des Zusammenhangs zwischen der Telomerverkürzung und der ESCRT-Maschinerie.

Zunächst haben wir die Telomerlänge nach mindestens 150 Generationen (sechs serielle Wiederholungen) durch Telomer-PCR (15) für verschiedene Telomere (Y'-enthaltende Telomere und Telomer 1L) in Wildtyp und gemessen Δvps27 Zellen. Abbildungꀪ zeigt die Gelquantifizierung für die Telomer-PCR und Abb.ꀫ einen repräsentativen Southern-Blot zur Messung der Telomerlängen nur für Y'-Telomere. Die Verkürzung der Telomere in Δvps27 Zellen war auffällig, wie bereits berichtet (5, 16). Da die Telomerlänge in knospenden Hefen hauptsächlich durch die Telomerase aufrechterhalten wird, haben wir untersucht, ob der Verlust der Telomerasefunktion denselben Weg beeinflusst wie der beeinträchtigte in Δvps27 Zellen. Wir haben die gelöscht EST2 Gen, das für die katalytische Untereinheit der Telomerase kodiert, und zeichnete das Wachstumspotenzial von Zellen (relative Zelldichte) und die entsprechende Telomerverkürzungsrate in Zellen mit oder ohne Deletion des VPS27 Gen. Aufgrund ihrer fehlenden Telomerase-abhängigen Telomer-Elongation, 㥎st2 Mutanten seneszieren nach einer bestimmten Anzahl von Passagen, seltene Überlebende tauchen später auf und übernehmen die Population. Wir fanden heraus, dass der Beginn der Seneszenz in 㥎st2 Δvps27 Doppelmutanten war ähnlich wie bei der Einzelmutante 㥎st2 Mutanten ( Abb.ꀬ ) und dass die Geschwindigkeiten der Telomerverkürzung bei beiden Mutanten vergleichbar waren ( Abb.ꀭ ). Daraus schließen wir, dass die Telomerverkürzung in Δvps27 Zellen ist auf eine Wirkung auf einen Telomerase-vermittelten Mechanismus zurückzuführen.

Die Telomerase-abhängige Telomerverlängerung ist gestört in vps27 Mutanten. (A) Die Telomerlänge wurde durch Telomer-PCR für Wildtyp und . gemessen Δvps27 Zellen nach dem Wachstum auf mindestens 150 Generationen (sechs serielle Wiederholungen). Die Länge wurde für sechs Y'-Telomere und das 1L-Telomer untersucht. Horizontale Balken repräsentieren die Mediane der jeweiligen Datenpunkte. (B) Repräsentativer Southern-Blot, der verwendet werden könnte, um Y'-Telomerlängen in Wildtyp- und zu messen Δvps27 Zellen. (C) Seneszenzkurven von 㥎st2 einzeln und 㥎st2 Δvps27 Doppelmutanten. Für jeden Mutantentyp wurde die Seneszenz für sechs verschiedene Sporenkolonien aufgezeichnet (n = 6). Fehlerbalken repräsentieren die Standardfehler der Mittelwerte. Zwei Fragmente, 2044 und 779 bp lang, dienen als Größenmarker in Telomer-Southern-Blots. (D) Relativer Basenpaarverlust von sechs Y'-Telomeren sowie dem 1L-Telomer, in 㥎st2 einzeln und 㥎st2 Δvps27 Doppelmutanten. Die Tage 1 bis 5 entsprechen den ersten fünf Zeitpunkten der Seneszenzkurve in Panel C. Der relative Basenpaarverlust wurde als Verhältnis der Anzahl der Basenpaare am Tag . berechnet x zur Anzahl der Basenpaare an Tag 1. Der durchschnittliche relative Basenpaarverlust in drei Tetraden (n = 3) pro Tag wird angezeigt. Fehlerbalken zeigen Mittelwerte ± Standardabweichungen an. Abbildung S3 im ergänzenden Material zeigt die in Panel D gemittelten Einzeldaten.

Um einen Defekt der Telomerase-vermittelten Elongation in weiter zu bestätigen 㥎SCRT Mutanten nutzten wir frühere Arbeiten, die zeigten, dass die Exposition von Zellen gegenüber Ethanolstress zu einer erhöhten Telomerverlängerung über die Telomerase führt (17). Wir haben die Telomerlänge durch Southern-Blot-Analyse in Wildtypzellen gemessen und 㥎SCRT Mutanten, die über 60 Generationen Ethanol (5% Ethanol in flüssigem, auf Glucose basierendem YP-Medium) ausgesetzt waren. Die durchschnittliche Telomerlänge wurde mit TelQuant (18) berechnet. Wie erwartet, 㥎SCRT Mutanten zeigten kürzere Telomere als Wildtypzellen. Außerdem, 㥎SCRT Mutanten zeigten eine schwächere Reaktion auf Ethanol als die Wildtypzellen in Bezug auf die Telomerverlängerung, mit Δvps27, Δstp22, und Δsnf8 Mutanten mit den stärksten Effekten ( Abb.ꀺ und ​ und B B siehe auch Abb. S2 im Ergänzungsmaterial). Diese Beobachtung legt nahe, dass die gesamte ESCRT-Familie an der Telomerase-abhängigen Verlängerung beteiligt ist und dass sie für die normale Telomererhaltung sowie für die physiologische Reaktion auf externe Signale erforderlich ist.

Verringerte Dehnungsraten von 㥎SCRT Mutanten als Reaktion auf Ethanolstress. (A) Die Telomerlänge wurde mit TelQuant (18) gemessen. Standardabweichungen sowie Werte für Einzelmessungen (graue Kreise) werden angezeigt. Die Dehnungsrate wurde als Differenz zwischen der endgültigen Telomerlänge (nach Einwirkung von 5% Ethanol über 60 Generationen) und der anfänglichen Telomerlänge (vor der Anwendung von Ethanolspannung) dividiert durch die anfängliche Länge jeder Dehnung berechnet.Danach wurde die Elongationsrate auf die Wildtyp-Elongationsrate normalisiert, die als eins angenommen wurde. (B) Southern Blot mit Wildtyp und Δsnf8 mutierte Telomerlängen vor (−) und nach (+) Exposition gegenüber Ethanol (EtOH) Stress (5% Ethanol in Standard-YP-Medium) von jeweils drei unabhängigen Kulturen.

Eine bioinformatische Analyse der Genexpression in 㥎SCRT Deletionsmutanten zeigten keine dramatischen Veränderungen in der Expression von Telomer-verwandten Genen. Angesichts der starken Konnektivität von Vps27 an Cdc13 im oben berichteten Protein-Protein-Interaktionsnetzwerk haben wir diesen Zusammenhang genauer untersucht. Cdc13 ist das wichtigste ssDNA-bindende Protein der Telomere in Hefe und reguliert den Zugang der Telomerase zu den chromosomalen Enden (19). Je nach Zellzyklusstadium wird Cdc13 in unterschiedlichen Komplexen an das Telomer gebunden. Entweder ist es als Mitglied des CST-Capping-Komplexes an den Telomerüberhang gebunden oder es interagiert mit Est1, um die Telomerase-Rekrutierung zu fördern (19). Est1 ist eine Untereinheit des Telomerase-Ribonukleoprotein-Komplexes und ist wichtig für in vivo Telomeraseaktivität an Telomeren (20). Wir erzwangen, dass die Telomerase an den Telomerüberhang angebunden wurde, indem wir ein Cdc13-Est1-Fusionsprotein verwendeten, was zu einer starken Telomerverlängerung in Wildtypzellen führte. Dieses Fusionsprotein kann verwendet werden, um zwischen einer defekten Telomerase-Rekrutierung und einer gestörten Telomerase-Aktivierung zu unterscheiden, obwohl es die korrekte Erzeugung eines G-Überhangs erfordert, der eine Cdc13-Bindungsstelle bereitstellt. Wenn das Fehlen der ESCRT-Untereinheiten die Telomerverlängerung aufgrund einer verringerten Telomeraserekrutierung beeinträchtigt, kann das Anbinden der Telomerase an das Telomer durch die Expression der Cdc13-Est1-Fusion das Problem umgehen und zu einer Wildtyp-Telomerverlängerung führen. Wenn andererseits die Telomeraseaktivität selbst in Abwesenheit von ESCRT-Untereinheiten beeinträchtigt ist, wird die Telomerverlängerung in Gegenwart des Cdc13-Est1-Fusionsproteins immer noch reduziert. Wir exprimierten dieses Fusionsprotein in sechs 㥎SCRT Mutanten (Δvps27, Δsnf8, Δvps20, Δsnf7, 㥍id4, und 㥍oa4 Mutanten) und bewerteten die Kinetik der Telomerverlängerung. Wir beobachteten, dass trotz der 𠇏orced” Rekrutierung die Telomerverlängerung bei allen Mutanten im Vergleich zu Wildtypzellen reduziert war ( Abb.਄ ). Diese Daten legen nahe, dass in 㥎SCRT Mutanten wird entweder die Aktivität der Telomerase beeinträchtigt oder der G-Überhang wird nicht richtig reguliert, was wiederum die Rekrutierung der Telomerase verhindert, selbst wenn sie gezwungen ist, an Telomeren vorhanden zu sein.

Reduzierte Telomerverlängerung in 㥎SCRT Mutanten trotz erzwungener Telomerase-Rekrutierung. Kinetik der Telomerverlängerung für Mutanten mit dem 㥎SCRT Mutationen gezeigt und der Wildtyp. Stämme, die Plasmide tragen, die das Cdc13-Est1-Fusionsprotein (oder eine leere Vektorkontrolle) exprimieren, wurden für acht Passagen auf –LEU-Platten ausgestrichen. An den angegebenen Tagen wurde DNA extrahiert, verdaut mit XhoI, und analysiert durch Southern-Blotting. Die Tage 4, 8, 12 und 16 entsprechen den Passagen 2, 4, 6 und 8. Fehlerbalken zeigen Mittelwerte ± Standardabweichungen an.

Wir wollten testen, ob die Endresektion und damit die G-Schwanzbildung beeinflusst wird in Δvps27 Mutanten. Verwenden von cdc13-1, ein temperaturempfindliches Allel von CDC13, Telomer-Entcapping kann durch Temperaturänderungen induziert werden. Nach dem Schalten cdc13-1 Zellen auf ihre nicht-permissive Temperatur (㸧ଌ), Telomere werden entdeckelt und extensiv lange G-Überhänge werden nukleaseabhängig erzeugt, was zu einem Checkpoint-vermittelten Zellzyklusarrest führt. In der Tat, wenn Nukleasen wie Exo1 in deletiert werden cdc13-1 Zellen sind die Zellen auch bei Temperaturen über 27ଌ lebensfähig. Wir untersuchten cdc13-1 Δvps27 Doppelmutanten auf ihre Lebensfähigkeit bei den permissiven (23ଌ und 25ଌ) und nichtpermissiven (27ଌ und 28ଌ) Temperaturen. Löschen VPS27 ermöglichte das Wachstum von cdc13-1 Zellen bei erhöhten Temperaturen ( Abb.ꁚ ). Dieser Befund stimmt mit den Ergebnissen von Addinall et al. überein, die berichteten, dass eine Streichung von HSE1 (ein Vps27-Interaktor) unterdrückt die Temperaturempfindlichkeit von cdc13-1 (21). Daher scheint die Deletion von ESCRT-0 die Zellen vor unbedeckten Telomeren zu schützen. Dieser Befund gilt für fast alle ESCRT-Gendeletionen (siehe Abb. S3 im Ergänzungsmaterial).

Löschung von VPS27 rettet cdc13-1 Capping-defekte Telomere. (A) Zellen mit den angegebenen Genotypen wurden in 10-fach Verdünnungsreihen auf Standard-YPD-Platten gespottet und bei verschiedenen Temperaturen für 3  Tage inkubiert. Zwei biologische Replikate sind gezeigt (N1 und N2). (B) Boxplot, das die Menge des Telomerüberhangs für zeigt cdc13-1 einzeln und cdc13-1 Δvps27 Doppelmutanten bei permissiver Temperatur (grün) und nach Hitzeschockbehandlung (1 h bei 30ଌ in blau). Grüne Punkte kennzeichnen die einzelnen Datenpunkte. (C) Wie für das Experiment beschrieben, dessen Ergebnisse in Tafel A gezeigt sind, wurden die angegebenen Mutanten auf Platten mit den angegebenen Medien aufgetüpfelt. Zellen enthielten entweder ein Exo1-Überexpressionsplasmid (OE) oder die entsprechende Vektorkontrolle (leerer Vektor [EV]). Exo1-Überexpression wurde durch Wachstum auf Galactose-haltigen Platten induziert. Die Platten wurden 3  Tage bei den angegebenen Temperaturen inkubiert. SD-Leu, synthetisches Dropout-Medium aus Hefe ohne Leucin (Kontrolle) SGalRaf-Leu, SD-Leu-Medium mit 1 % Raffinose und 2 % Galactose.

Sowohl eine reduzierte Exo1-vermittelte Resektion als auch/oder eine defekte Aktivierung des Zellzyklus-Checkpoints könnten möglicherweise für das erhöhte Wachstum von . verantwortlich sein cdc13-1 Zellen bei erhöhter Temperatur. Zuerst haben wir untersucht, ob die Löschung von VPS27 beeinflusst die Exo1-vermittelte Resektion. Der Abbau des 5′ Endes von unverkappten Telomeren führt zu erhöhten Mengen an 3′ telomeren einzelsträngigen Überhängen. Wir haben die Menge an telomerer ssDNA in gemessen cdc13-1 und cdc13-1 Δvps27 Zellen bei 23ଌ oder nach 1 h Inkubation bei 30ଌ, um die Telomer-Entkappung zu induzieren. Wie erwartet, sahen wir erhöhte Werte von 3′ ssDNA in cdc13-1 Zellen bei hoher Temperatur unter Verwendung eines Dot-Blot-Ansatzes unter nativen und denaturierenden Bedingungen ( Abb.ꁛ siehe auch Abb. S4 im Ergänzungsmaterial). Die Menge des telomeren Überhangs von 3′ war in der Doppelmutante bei beiden Temperaturen verringert ( Abb.ꁛ ). Diese Beobachtung deutet auf eine kompromittierte Exo1-vermittelte Resektion bei cdc13-1 Δvps27 Doppelmutanten. Außerdem Überexpression von Exo1 in cdc13-1 Δvps27 Zellen (aber kein leerer Vektor) beseitigten den Rescue-Effekt ( Abb.ꁜ ), was die Idee einer defekten Exo1-vermittelten Resektion nach VPS27 Streichung. Um zu testen, ob Δvps27 Mutanten haben möglicherweise eine geringere Expression von EXO1, haben wir die Proteinspiegel von Exo1 in Δvps27 Einzelmutanten und cdc13-1 Δvps27 Doppelmutanten im Vergleich zu den Spiegeln in Wildtyp-Zellen nach der Induktion der Telomer-Entkappung durch Übertragung auf hohe Temperatur (1 h bei 30ଌ). Wir untersuchten auch die Abbaukinetik von Exo1 in den Doppelmutanten mit Cycloheximid-Chase-Experimenten. Die Exo1-Werte wurden durch das Löschen von nicht verändert VPS27, und es gab keine offensichtlichen Unterschiede in der Kinetik des Proteinabbaus von Exo1 zwischen cdc13-1 und cdc13-1 Δvps27 Mutanten. Zusammengenommen legen diese Ergebnisse nahe, dass die Rettung von cdc13-1 Zellen durch das Löschen von ESCRT Komponenten können auf eine beeinträchtigte Resektion des Telomers zurückzuführen sein, obwohl Unterschiede in EXO1 Ausdruck kann nicht zur Rechenschaft gezogen werden.

Abgesehen von einer fehlerhaften Exo1-vermittelten Resektion könnte auch eine unsachgemäße Aktivierung des DNA-Schadens-Checkpoints die scheinbare Rettung von . erklären cdc13-1 Capping-defekte Telomere. Zuvor wurde ein Up-Down-Assay ( Abb.ꁪ ) entwickelt, bei dem Zellen Zyklen hoher und niedriger Temperatur ausgesetzt werden (21). Da die Temperaturempfindlichkeit von cdc13-1 Mutanten reversibel ist, können die Zellen ihre Lebensfähigkeit nach kurzer Exposition gegenüber der nicht-permissiven Temperatur aufrechterhalten, wenn sie danach wieder auf die permissive Temperatur zurückgebracht werden. Mutanten, die für die Aktivierung des DNA-Schadens-Checkpoints defekt sind, können als Reaktion auf DNA-Schäden nicht angehalten werden, und eine Wiederherstellung ist nicht möglich (21). Unter diesen Bedingungen können Mutationen in EXO1 unterdrücken cdc13-1 Mängel, während eine Streichung der RAD9 Checkpoint-Gen ist dazu nicht in der Lage (21). Die Ergebnisse in Abb.ꁫ zeigen, dass die cdc13-1 Δvps27 Mutanten waren in diesem Assay lebensfähig, im Gegensatz zu Checkpoint-defekten Δrad9 Zellen, was darauf hinweist, dass die Checkpoint-Aktivierung in Abwesenheit von . normal ist VPS27.

cdc13-1 Δvps27 Doppelmutanten sind in einem Up-Down-Assay lebensfähig. (A) Schema des verwendeten Up-Down-Assays. Die Zellen wurden 5 h bei permissiver Temperatur (23ଌ) inkubiert, gefolgt von einer Phase der nichtpermissiven Temperatur (36ଌ) für 5 h. Nach drei Zyklen wurden die Platten bei 23ଌ gehalten. (B) Die Zellen wurden in 10-fach Verdünnungsreihen auf Standard-YPD-Platten gespottet, die 3 Tage bei oszillierenden Temperaturen inkubiert wurden. Zwei biologische Replikate wurden gesichtet. Kontrollen wurden bei 23ଌ inkubiert.


Das Altern des Menschen hat sich in der Studie "Heiliger Gral" umgekehrt, sagen Wissenschaftler

Wissenschaftler behaupten, den biologischen Alterungsprozess bei einer Gruppe älterer Erwachsener erfolgreich umgekehrt zu haben.

In einer ersten Studie einer Art verwendeten Forscher der Universität Tel Aviv und des Shamir Medical Center eine Form der Sauerstofftherapie, um zwei Schlüsselindikatoren der biologischen Alterung umzukehren: die Länge der Telomere und die Ansammlung von seneszenten Zellen.

Wenn der menschliche Körper älter wird, erfährt er eine Verkürzung der Telomere – die Schutzkappen am Ende der Chromosomen – und eine Zunahme alter, funktionsgestörter alternder Zellen.

In einer klinischen Studie mit 35 Erwachsenen über 64 Jahren wurde untersucht, ob eine Methode namens hyperbare Sauerstofftherapie die Verschlechterung dieser beiden Kennzeichen des Alterungsprozesses verhindern könnte.

Die Probanden wurden in eine Druckkammer gesetzt und erhielten 90 Minuten am Tag, fünf Tage die Woche drei Monate lang reinen Sauerstoff.

Am Ende der Studie berichteten die Wissenschaftler, dass sich die Telomere der Teilnehmer um durchschnittlich 20 Prozent verlängert und ihre seneszenten Zellen um bis zu 37 Prozent reduziert hatten.

Dies entspricht dem, wie sich ihre Körper 25 Jahre zuvor auf zellulärer Ebene befanden, berichteten die Forscher.

„Da die Telomerverkürzung als der ‚Heilige Gral‘ der Biologie des Alterns gilt, werden viele pharmakologische und umweltbezogene Interventionen intensiv erforscht, in der Hoffnung, eine Telomerverlängerung zu ermöglichen“, sagte Shai Efrati, Professor an der Fakultät für Medizin und Sagol School of Neurowissenschaften an der Universität Tel Aviv und Co-Autor der Studie.

„Die signifikante Verbesserung der Telomerlänge, die während und nach diesen einzigartigen HBOT-Protokollen gezeigt wurde, bietet der wissenschaftlichen Gemeinschaft eine neue Grundlage für das Verständnis, dass das Altern tatsächlich auf der grundlegenden zellbiologischen Ebene gezielt und rückgängig gemacht werden kann.“

Empfohlen

Es ist die neueste in einer Reihe von radikalen Anti-Aging-Behandlungen, die darauf abzielen, die Lebenserwartung zu erhöhen und Menschen sogar jünger aussehen und fühlen zu lassen.

Die Idee ist, dass das Altern eine Krankheit ist, die wie jede andere geheilt werden kann.

Im Jahr 2015 machte die Chefin eines Biotech-Unternehmens Schlagzeilen, nachdem sie bei einer neuartigen Gentherapie Patientin Null wurde, von der sie behauptete, dass sie dauerhafte Veränderungen an ihrer DNA vornehmen könnte, um Muskelverlust und andere altersbedingte Erkrankungen zu bekämpfen.

BioViva-Geschäftsführerin Liz Parrish erhielt Kritik von Wissenschaftlern für ihre experimentelle Medikamentenstudie, behauptet jedoch, die Länge ihrer Telomere in den fünf Jahren seither erhöht zu haben, und behauptete kürzlich, dass der Tod optional ist.

Während der jüngsten Studie in Israel wurden bei den Teilnehmern keine Änderungen des Lebensstils, der Ernährung oder der Medikation vorgenommen, die zuvor moderate Auswirkungen auf das biologische Alter einer Person hatten.

Es versteht sich, dass die Auswirkungen stattdessen darauf zurückzuführen waren, dass die unter Druck stehende Kammer einen Zustand von Hyperoxie oder hohen Sauerstoffspiegeln im Blut hervorrief, die die Zellregeneration verursachten.

„Bis jetzt wurde gezeigt, dass Interventionen wie Lebensstiländerungen und intensives Training eine gewisse Hemmwirkung auf die erwartete Verkürzung der Telomerlänge haben“, sagte Dr. Amir Hadanny, Co-Autor der Studie.

„Bemerkenswert in unserer Studie ist jedoch, dass wir in nur drei Monaten Therapie eine so signifikante Telomerverlängerung erzielen konnten – mit Raten, die weit über alle derzeit verfügbaren Interventionen oder Lebensstiländerungen hinausgehen.“


Rekombinatorische Telomerverlängerung, gefördert durch DNA-Kreise

FEIGE. 1. Sich wiederholende Struktur innerhalb der Telomere von ter1-Δ Überlebende. (A) Strategie für den Bau von ter1-Δ-Stämme mit zwei Arten von Telomer-Repeats. Die ter1-Δ-Stamm mit Wildtyp-Telomer-Wiederholungen an der Basis und Bcl-Telomer-Wiederholungen an den Spitzen wurde durch Bildung von a ter1-Δ/TER1-Bcl Heteroallel. Beschichtung auf 5-FOA ausgewählt für Zellen, die entweder die TER1-Bcl Allel oder das ter1-Δ Allel. Klone, die nur die . enthalten ter1-Δ-Allel wurden durch ihren seneszenten rauen Kolonie-Phänotyp identifiziert. (B) Ergebnisklassen, die bei Überlebenden nach der Seneszenz beobachtet wurden, abgeleitet von ter1-Δ-Stämme mit Wildtyp- und Bcl-Wiederholungen. Hellgraue Kästchen zeigen Wildtyp-Wiederholungen an, dunkelgraue Kästchen zeigen Bcl-Wiederholungen an und weiße Kästchen zeigen partielle Wiederholungen an, die weder als Wildtyp noch als Bcl unterscheidbar sind. Dünne Linien repräsentieren die subtelomere Sequenz. Die für die Ergebnisse 1 und 2 gezeigten Telomerstrukturen sind ungefähre basierend auf BclIch Restriktionsverdau und nicht Sequenzierung. Telomerstrukturen für Ergebnis 3 sind klonierte und sequenzierte Beispiele von rekombinatorisch verlängerten Telomeren von drei unabhängigen Postseneszenz-Überlebenden. Es gibt keine Sequenzvariation von Wildtyp-Telomer-Wiederholungen in den klonierten Telomeren mit Ausnahme der Position, von der erwartet wird, dass sie a . erzeugt BclI Restriktionsseite. (C) Southern-Blot, hybridisiert mit einer Telomersonde, eines seneszenten ter1-Δ-Stamm (Spur ) und 11 davon abgeleitete Postseneszenz-Überlebende, die Bcl-Wiederholungen behielten (Spur 1 bis 11). Spurpaare zeigen DNA von einzelnen Überlebenden, die mit verdaut wurden ÖkoRI und ÖkoRI-BclI. Unter den 12 Telomeren subtelomere ÖkoRI-Stellen sind 1 bis 3,5 kb von den telomeren Enden entfernt. Der Doppelverdau ergibt Blöcke von Wildtyp-Repeats. Das untere Feld zeigt diese Blöcke aufgelöst auf einem 4% NuSieve-Agarose-Gel. Größenmarkierungen für beide Platten sind angegeben. Die geklonten Telomere in Tafel B (1a, 1b und 1c und 3a, 3b und 3c) stammten aus den Klonen 1 bzw. 3 von Tafel C. Das geklonte Telomer 12a von Tafel B wurde aus einem Klon isoliert, der in Tafel C nicht gezeigt ist. FEIGE. 2. Lange Tandem-Arrays an Telomeren nach Transformation mit einem DNA-Kreis mit URA3 und telomere Wiederholungen. (A) Southern Blot, hybridisiert mit einer subtelomeren Sonde, von ÖkoRI-verdaute DNA aus Wildtyp TER1 (WT) und ter1-Δ (Δ) Stämme untransformiert (Bahnen 1 und 2) und nach Transformation (Bahnen 3 bis 6) mit einem 1,6-kb URA3-Telomerkreis. (B) Gleicher Filter wie in Tafel A nach dem Abisolieren und erneuten Sondieren mit a URA3 Sonde. (C) Southern Blot, hybridisiert an eine Telomersonde, von ungeschnittener genomischer DNA aus TER1 (WT) und ter1-Δ (Δ) Stämme transformiert mit dem 1,6-kb URA3-Telomerkreis. Die gezeigten Transformanten sind die gleichen wie die in den Feldern A und B gezeigten. (D) Southern Blot, hybridisiert mit a URA3 Sonde, von ÖkoRV-verdaute DNA aus Wildtyp TER1 (WT) und ter1-Δ (Δ) Stämme untransformiert (Bahnen 1 und 2) und nach Transformation (Bahnen 3 bis 6) mit einem 1,6-kb URA3-Telomerkreis. (E) Diagramm von 1,6-kb URA3-Telomerkreistransformation und Strukturen von einzelnen und mehreren Tandeminserts und einem Telomer. Graue Kästchen zeigen Blöcke von Telomer-Wiederholungen an, schwarze Kästchen zeigen URA3weiße Kästchen zeigen eine kurze subtelomere Sequenz an, die auf DNA-Kreisen vorhanden ist, und gepunktete Kästchen zeigen eine subtelomere Sequenz an, die als Sonde in Tafel A verwendet wurde und in den Kreisen nicht vorhanden ist. Subtelomere ÖkoRI-Stellen sind 1 bis 3,5 kb von den Telomer-Enden in untransformierten K. lactis Zellen. Positionen von ÖkoRI-Standorte(RI) und ÖkoRV (RV)-Stellen sind angegeben. Abkürzungen: J, Centromer-Proximal-Junction-Fragment T, Telomer-Fragment. FEIGE. 3 . Die Transformation mit zwei Kreisarten erzeugt Arrays, die von nur einer Art abgeleitet sind. (A) Diagramm der Telomerstrukturen vor und nach Einführung einer Mischung aus zwei Spezies von 1.6-kb URA3-Telomerkreise, die sich nur durch eine einzige Restriktionsstelle unterscheiden. Graue und schwarze Kästchen sind Blöcke von Telomer-Wiederholungen und URA3, bzw. Weiße Kästchen sind subtelomere Sequenzen, die auf DNA-Kreisen vorhanden sind, und gepunktete Kästchen sind subtelomere Sequenzen, die auf den Kreisen nicht vorhanden sind. Abkürzungen: R, S und P, Seiten für ÖkoRI, SalIch und PvuI- bzw. S/P-Sites, die entweder Salich oder PvuI, je nachdem, von welchem ​​Kreis die Stelle von J und T abgeleitet ist, Verbindungsfragment mit subtelomeren Sequenzen bzw. terminalem Telomerfragment. (B) Southern Blots von repräsentativen Klonen von TER1 (oben) und ter1-Δ (unten) transformiert mit entweder Kreis S oder Kreis P sind hybridisiert mit Subtelomer gezeigt, URA3oder Telomersonde, wie angegeben. Untransformierte Kontrolle wird mit verdaut gezeigt ÖkoRI, und die Transformanten sind mit verdaut gezeigt ÖkoRI (-), ÖkoRI-SalIst oder ÖkoRI-Pvuich (P). Der Typ des verwendeten Transformationskreises ist oben angegeben. Eine schwache Bande bei 3,2 kb in URA3-sondierte Spuren, die das dunkle 1,6-kb-Fragment enthalten, sind Spurenteile, die von der Spaltung der Tandem-Arrays übrig bleiben. Positionen von Molekulargewichtsmarkern (in Kilobasenpaaren) sind angegeben. (C) Southern-Blots von jeweils zwei repräsentativen Klonen von TER1 (oben) und ter1-Δ (unten) transformiert mit Kreis S und Kreis P sind hybridisiert mit Subtelomer gezeigt, URA3oder Telomersonde, wie angegeben. Die beiden Klone repräsentieren jeweils ein Beispiel von Klonen, die Tandem-Arrays entweder einer S-Version oder einer P-Version aufweisen. Der Verdau wurde wie für Panel B durchgeführt. (B und C) Junction-Fragmente (J) sind mit Pfeilen in der markiert URA3. FEIGE. 4. URA3-Telomerkreistransformation in rad52 und RAD52 Stämme. Fotografien zeigen Plattenabschnitte mit Ura+-Transformanten. Gleiche Mengen von beiden URA3-Telomer (Tel.)-Kreis und die autonom replizierende ARS-Plasmidkontrolle wurden für beide Stämme verwendet. FEIGE. 5. Lange Tandemanordnungen an Telomeren können in a . gebildet werden TER1 rad52 Stamm transformiert mit a URA3-Telomerkreis.Gezeigt ist ein Southern-Blot der untransformierten Kontrolle (C) und drei rad52 mit a . transformierte Klone URA3-Telomerkreis. Die untransformierte Kontrolle wird mit verdaut gezeigt ÖkoRI, und die transformierten Klone sind mit verdaut gezeigt ÖkoRI und ÖkoRI-PvuIch, wie angegeben. Derselbe Filter ist hybridisiert mit subtelomeren, URA3und Telomersonden. Schwache Bänder bei 1,6 kb in ÖkoRI-PvuI-verdaute Proben, die mit der subtelomeren Sequenz hybridisiert sind, sind Restsignale von früheren URA3 Hybridisierung. Größenmarker (in Kilobasen) sind links dargestellt. FEIGE. 6. Roll-and-Spread-Modell. Es wird postuliert, dass die Bildung eines langen Telomers über eine Rolling-Circle-Genkonversion erfolgt, die entweder den 1,6-kb-Kreis (Kreistransformanten) oder einen sehr kleinen Telomerkreis kopiert (ter1-Δ Überlebende). Der Einschub zeigt ein telomerisches Ende, das so bearbeitet wurde, dass es einen 3′-Einzelstrangüberhang (schraffierte dünne Kästchen) aufweist, der in einen Telomerkreis eindringt. In ter1-Δ-Zellen, kann die sehr hohe Rate der telomerischen Genkonversion die Sequenz von einem langen Telomer auf viele oder alle anderen Telomere der Zelle unter Selektionsdruck für Überlebende nach der Seneszenz verteilen. Das Nettoergebnis ist, dass in den meisten oder allen verlängerten Telomeren ein gemeinsames Muster vorhanden ist.

Ergebnisse

Die Telomerase-Komponenten TERT und TERC können mit RNAscope . zuverlässig nachgewiesen werden

Wir haben uns entschieden, mit HeLa-Zellen als Modellsystem zu arbeiten, da sie eine der wenigen Zelllinien darstellen, bei denen die Telomerase-Dynamik zuvor auf Einzelzellebene untersucht wurde. Einzelzellklonierungsexperimente legten nahe, dass innerhalb einer HeLa-Population mit stabiler mittlerer Gesamt-Telomerlänge eine signifikante Heterogenität sowohl hinsichtlich der Telomerlänge als auch der Telomeraseaktivität besteht [23]. Darüber hinaus hat eine kürzlich durchgeführte Studie mit einer TRAP-Assay-Variante basierend auf Tröpfchen-PCR ergeben, dass

30% der HeLa-Zellen fehlt TRAP-Aktivität [16], und wir haben berichtet, dass der Großteil der Telomerverlängerung in HeLa-Zellen innerhalb einer kleinen Untergruppe von Zellen stattfindet [17]. Zusammengenommen legen diese Ergebnisse nahe, dass sowohl die Telomerlänge als auch die Telomeraseaktivität innerhalb einzelner Zellen einer HeLa-Population signifikant heterogen sind, aber die dieser Heterogenität zugrunde liegenden regulatorischen Mechanismen sind ungewiss.

Wir stellten die Hypothese auf, dass die heterogenen Telomer-Elongationsmuster, die in unserer früheren Arbeit in HeLa-Zellen beobachtet wurden, zumindest teilweise durch die heterogene TERT-Expression angetrieben werden. Um die TERT-Expression zu beurteilen, verwendeten wir RNAscope in situ-Hybridisierungsdetektion [18, 24]. Durch den Einsatz umfassender Signalverstärkung ermöglicht diese proprietäre Technik den Nachweis von mRNA auf Einzelmolekülebene.

Um den RNAscope-Nachweis von Telomerase-Komponenten zu validieren, testeten wir zunächst RNAscope-Sonden für TERC und TERT in Kontroll-HeLa-Zellen und in HeLa-Zellen, die TERT (HeLa TERT) und/oder mutiertes TSQ1 TERC (HeLa TSQ1 HeLa TERT TSQ1) überexprimieren. In Übereinstimmung mit veröffentlichten Daten, die belegen, dass TERC ubiquitär exprimiert wird, während die TERT-Spiegel typischerweise geschwindigkeitsbeschränkend sind [5𠄷, 14], war die TERC-Expression in der HeLa-Kontroll-Zellpopulation viel höher als die TERT-Expression (Abb. 1). Die TERT-Expression war sowohl niedrig als auch heterogen, wobei ungefähr 30% der Zellen für TERT RNAscope negativ waren. Wenn eine der Telomerasekomponenten exogen überexprimiert wurde, zeigte der RNAscope-Test eine entsprechende Zunahme der Signalintensität. In jedem Fall bezieht sich “vec” auf die Leervektorkontrolle für die TSQ1-Infektion. Die subzelluläre Lokalisation der beiden Telomerase-Komponenten war unterschiedlich, wobei TERT-mRNA sowohl im Zellkern als auch im Zytoplasma nachgewiesen wurde und TERC-RNA überwiegend im Zellkern zu sehen war. Zusammengenommen zeigen diese Ergebnisse, dass RNAscope einen sensitiven Nachweis von sowohl TERC als auch TERT in einzelnen Zellen einer heterogenen Population ermöglicht. Um die Spezifität des RNAscope-Assays weiter zu bestätigen, analysierten wir die TERT-Expression in zwei Krebszelllinien, von denen bekannt ist, dass sie Telomerase exprimieren (LOX und HCT116) [17, 25] und zwei Fibroblastenzelllinien, von denen bekannt ist, dass sie Telomerase-negativ sind (WI38 und MRC5) [26 , 27]. In den Krebszelllinien wurde ein robustes RNAscope-TERT-Signal beobachtet, während in den Fibroblasten-Zelllinien nur extrem seltene RNAscope-TERT-Flecken beobachtet wurden ( 2A und 2B ).

A. Repräsentative Bilder, die HeLa-Zellen und HeLa-Zellen zeigen, die TERT (HeLa TERT) überexprimieren, gefärbt für TERT-mRNA und TERC. Jeder dieser Zelltypen wurde mit einem lentiviralen Plasmid infiziert, das die TSQ1-Mutante TERC oder eine Vektorkontrolle (vec) exprimiert. Maßstabsbalken bezeichnen 10μM. B. qPCR zur Messung der TERT- und TERC-Expression in HeLa vec-, HeLa TSQ1-, HeLa TERT vec- und HeLa TERT TSQ1-Zellen. In jedem Fall werden die Pegel als fold change over control HeLa vec Pegel ausgedrückt. C. Häufigkeitsverteilung von RNAscope-TERT-Foci in Populationen von HeLa- und HeLa-TERT-Zellen. Die Daten stammen aus 3 Sätzen biologischer Replikate, die jeweils 100 Zellen für jeden Zelltyp enthalten.

A. RNAskop für die TERT-Expression in Telomerase-negativen (MRC5- und WI38-Fibroblasten) und positiven (HCT116 und LOX) Zelllinien. B. Häufigkeitsverteilung von TERT RNAscope-Signalen innerhalb von Populationen von MRC5-, WI38-, HCT 116- und LOX-Zellen. Die Daten stammen aus 3 Sätzen biologischer Replikate, die jeweils 100 Zellen für alle Zelltypen enthalten. Maßstabsbalken bezeichnen 10μM.

Um auszuschließen, dass der Nachweis von genomischer DNA und nicht von mRNA-Transkripten zum nuklearen TERT RNAscope-Signal beitrug, führten wir den TERT RNAscope-Assay nach RNAse-Behandlung von HeLa-TERT-Zellen nach der Fixierung durch. Die RNAse-Behandlung eliminierte das TERT-RNAskop-Signal vollständig, was darauf hinweist, dass die RNAskop-Spots eher mRNA als genomische DNA darstellen (S1A Fig.). Da unser ultimatives Ziel darin bestand, den TERT-Nachweis und PNA-FISH zu kombinieren, testeten wir schließlich, ob das braune RNAscope-Diaminobenzidin (DAB)-Reaktionsprodukt über das PNA-FISH-Protokoll stabil war. Wir führten TERT RNAscope an HeLa TERT-Zellen durch, bildeten sie im Hellfeld ab und führten anschließend PNA-FISH auf denselben Objektträgern durch. Wie in S1B Fig. gezeigt, ist das DAB-Reaktionsprodukt durch das PNA-FISH-Verfahren stabil, obwohl die Hämatoxylin-Färbungsintensität nach PNA-FISH wesentlich reduziert ist.

Die Kombination von RNAscope und PNA-FISH TSQ1-Analyse ermöglicht den Nachweis von TERT-Expression, Telomerlänge und Telomerverlängerung in Einzelzellen

Die beobachtete Heterogenität der TERT-RNA in HeLa-Zellen entspricht der Heterogenität der Telomerverlängerung, die zuvor von unserem Labor berichtet wurde [17], was darauf hindeutet, dass die TERT-Spiegel ein zugrunde liegender Treiber der heterogenen Telomerase-Aktivität in der gesamten Bevölkerung sein können. Um diese Hypothese zu testen, haben wir einen kombinierten RNAscope TSQ1-Assay entwickelt. Kurz gesagt, TSQ1 TERC wird in HeLa- oder HeLa-TERT-Zellen für 5𠄷 Tage überexprimiert, wonach RNAscope-Nachweis von TERT-Transkripten gefolgt von Fluoreszenz-in-situ-Hybridisierungsnachweis der Wildtyp-Telomersequenz (TTAGGG-Wiederholungen) und der TSQ1-Telomersequenz (TTGCGG) ist durchgeführt. Die anschließende Hellfeld- und Fluoreszenz-Bildgebung ermöglicht die Einzelzelldetektion von TERT-mRNA (RNAscope-Spots im Hellfeld), Telomerlänge (Wildtyp-Telomer-Fluoreszenzsignal) und Telomer-Elongation (TSQ1-Telomer-Fluoreszenzsignal). Repräsentative Bilder aus dem kombinierten RNAscope/TSQ1-Assay sind in Fig. 3 gezeigt, mit zusätzlichen Bildern in S2 der TSQ1-Einbau ist in den HeLa-TERT-Zellen viel größer ( 4 ). Insgesamt sind 93% der HeLa-TERT-Zellen positiv für den TSQ1-Einbau gegenüber 44% der HeLa-Zellen. Darüber hinaus gibt es in HeLa-TERT-Zellen im Vergleich zu HeLa-Zellen viermal mehr TSQ1-Spots pro TSQ1-positiver Zelle (pπ.0001 Mann-Whitney-Test). Insgesamt wurden 171 Zellen aus mindestens zwei unabhängigen Experimenten für jeden Zelltyp untersucht, um diese Daten zu bestimmen. Wichtig ist, dass fast jede mit dem TSQ1-exprimierenden Virus behandelte Zelle eine ausgeprägte TERC-Überexpression im Vergleich zur Kontrolle zeigt (S3 Fig.).

Die Zellen wurden 7 Tage nach der TSQ1- oder Vektorinfektion getestet. Sie wurden mittels Fluoreszenz für Wildtyp-Telomer (grün) und TSQ1 (rot) Signal und dann Hellfeld für das braune TERT DAB-Reaktionsprodukt abgebildet. TSQ1-Spots, die an Telomeren kolokalisieren, sind mit Pfeilen markiert. Repräsentative Bilder werden angezeigt und Maßstabsbalken bedeuten 10μM.

Schwarmdiagramme, die die Anzahl der TSQ1-Spots zeigen, die mit Telomeren in HeLa-Zellen und HeLa-Zellen, die TERT überexprimieren, kolokalisieren. 171 Zellen aus mindestens 2 getrennten Experimenten wurden für jede Gruppe getestet. Mittelwerte (horizontale schwarze Linien) und SEM (rote Linien) werden für jede Population angezeigt. P-Werte (Mann-Whitney-Test) sind angegeben und signifikante Unterschiede sind mit Sternchen gekennzeichnet.

Wir beobachteten ferner, dass einige HeLa-Zellen, die TERT exprimieren, einen TSQ1-Einbau zeigen ( 5A , obere Felder), während andere Zellen signifikante Mengen an RNAscope-TERT-Signal, aber keinen nachweisbaren TSQ1-Einbau zeigen ( 5A , untere Felder). Über die gesamte HeLa-Zellpopulation wird eine schwache, aber statistisch signifikante Korrelation zwischen dem TSQ1-Einbau und den RNAscope-TERT-Spiegeln beobachtet (Spearman r = 0,275 p < 0,003) ( 5B , linkes Feld), was zeigt, dass die variable TERT-Expression eine Determinante von ist das heterogene Telomer-Elongationsmuster, das in einer HeLa-Zellpopulation beobachtet wurde. Jedoch zeigt eine signifikante Anzahl von Zellen mit TERT-Expression, die durch RNAscope niedrig oder nicht nachweisbar ist, dennoch einen robusten TSQ1-Einbau an den Telomeren, während vielen Zellen mit mehreren RNAscope-TERT-Spots ein nachweisbarer TSQ1-Einbau fehlt. Das Vorhandensein solcher Zellen legt stark nahe, dass andere Regulationsmechanismen als das TERT-Expressionsniveau auch das Ausmaß der Telomerasefunktion in einzelnen Zellen der Population regulieren.

A. Repräsentative Bilder von HeLa-Zellen mit robuster TERT-Expression und entweder robustem TSQ1-Einbau (oberes Bildfeld) oder ohne TSQ1-Einbau (unteres Bildfeld). Pfeile zeigen TSQ1-Spots an, die mit Telomeren kolokalisieren. Vergrößerte Bilder der eingerahmten Bereiche befinden sich in der unteren rechten Ecke jedes entsprechenden Bildes. Maßstabsbalken bezeichnen 10μM. B Streudiagramm, das die Korrelation zwischen dem TSQ1-Einbau und der TERT-Expression in HeLa (linke Tafel) und HeLa POT1-ΔOB-Zellen (rechte Tafel) zeigt. 171 Zellen aus mindestens 2 getrennten Experimenten wurden für jede Gruppe getestet. C. Schwarmdiagramme, die die Anzahl der TSQ1-Spots zeigen, die mit Telomeren kolokalisieren (linkes Feld) und die RNAscope-TERT-Expression (rechtes Feld) in HeLa-Zellen und HeLa-Zellen, die POT1-ΔOB überexprimieren. 171 Zellen aus mindestens 2 getrennten Experimenten wurden für jede Gruppe getestet. Mittelwerte (horizontale schwarze Linien) und SEM (rote Linien) werden für jede Population angezeigt. P-Werte sind angegeben und signifikante Unterschiede sind mit Sternchen gekennzeichnet, wobei ns einen nicht signifikanten Unterschied bezeichnet. Bemerkenswert ist, dass die in dieser Figur quantifizierten HeLa-Zellen die gleichen wie die in 4 gezeigte Kohorte sind.

Das Fehlen einer nachweisbaren Telomerverlängerung in vielen der TERT-positiven Zellen kann auf eine negative Regulierung der Telomeraseaktivität zurückzuführen sein. Mehrere Shelferin-Komponenten wurden als negative Regulatoren der Telomerverlängerung in Verbindung gebracht [28], und die Überexpression einer mutierten Form von POT1, der die OB-Faltungsdomäne fehlt (POT1-ΔOB), unterbricht diese negative Regulation und induziert die Telomerverlängerung [29]. Wir testeten die Rolle der Shelterin-Regulierung, indem wir eine kombinierte RNAscope/TSQ1-Analyse in HeLa-Zellen durchführten, die POT1-ΔOB überexprimieren, parallel zu dem im obigen Absatz beschriebenen HeLa-Zellexperiment.

Die POT1-ΔOB-Überexpression induzierte eine Volumen-Telomerverlängerung, gemessen durch Southern-Blot (S4 Fig.), was den erwarteten Einfluss auf die Telomerlängenregulierung bestätigt. Genau wie die Kontroll-HeLa-Zellen zeigen die HeLa-Zellen mit POT1-ΔOB-Überexpression ( 5B , rechtes Feld) eine schwache, aber statistisch signifikante positive Korrelation zwischen der TERT-Expression, gemessen anhand der RNAscope-Spot-Nummer, und der Telomer-Elongation, gemessen am TSQ1-Spot Nummer. Die durchschnittliche Anzahl der TSQ1-Spots stieg jedoch von 5,7 in HeLa-Zellen auf 9,4 in HeLa-Zellen, die POT1-ΔOB überexprimierten (p = 0,0013 Mann-Whitney-Test). Dieser Anstieg des TSQ1-Einbaus war nicht das Ergebnis einer erhöhten TERT-Expression, da sich das Niveau des TERT-RNAscope-Signals zwischen HeLa- und HeLa-POT1-ΔOB-Zellen nicht signifikant unterschied (p = 0,8881 Mann-Whitney-Test) (Abb. 5C, rechtes Feld). ). Insgesamt legt dieses Ergebnis nahe, dass das Fehlen eines robusten TSQ1-Einbaus in vielen TERT-positiven Zellen das Ergebnis einer negativen Regulation durch den Telomer-Shelterin-Komplex ist, und dass eine Störung dieser negativen Regulation zu einer stärkeren Telomerase-gerichteten Telomer-Elongation über viele Zellen des Population.

Schließlich untersuchten wir die Korrelation zwischen der Intensität des TERT-RNAscope-Signals und der Telomerlänge in HeLa-Zellen, um zu bestimmen, ob variable TERT-RNA-Spiegel die Telomerlängenheterogenität antreiben. Wir fanden keine Korrelation zwischen der Anzahl der RNAscope-TERT-Spots in einer Zelle und der durchschnittlichen Telomerlänge in dieser Zelle (S5A Abb). Diese Beobachtung trifft mit oder ohne Korrektur der Zentromer-Fluoreszenzintensität zu, was darauf hinweist, dass ein differentieller Sondenzugang nicht für das beobachtete Ergebnis verantwortlich ist (S5B Fig.). Somit korreliert die Telomerlänge in einzelnen Zellen der Population nicht mit der zu einem einzigen Zeitpunkt gemessenen TERT-Expression.


Methoden zur Schätzung der Telomerlänge

Zur Messung der Telomerlänge stehen mehrere Methoden zur Verfügung. Diese beinhalten unterschiedliche technische Schwierigkeitsgrade und Hintergrundinformationen zum Genom der beteiligten Arten. Die Methoden unterscheiden sich auch im Detaillierungsgrad, in der Zeit und der Ausrüstung, die für die Verarbeitung jeder Probe erforderlich sind, und in den damit verbundenen finanziellen Kosten. In Tabelle 1 bieten wir eine kurze, übergreifende Zusammenfassung der Hauptunterschiede zwischen diesen Methoden, und im Folgenden erläutern wir jede Methode detaillierter und stellen wichtige Referenzen für weitere Informationen bereit.

Telomer-Restriktionsfragment-Assay

Der TRF-Assay wurde vor über 20 Jahren entwickelt, um die mittlere Telomerlänge aus der Verteilung von Telomer-Restriktionsfragmenten zu messen, die durch den Verdau von DNA mit Restriktionsenzymen erzeugt wurden, die nicht innerhalb der Telomersequenz schneiden (Harley, Futcher & Greider 1990). Sie gilt weiterhin als „goldener Standard“ zur Messung von TL und wird häufig zur Validierung und Optimierung neuer Methoden oder ihrer Anwendung in neuen Arten oder Umgebungen verwendet (Criscuolo et al. 2009 Kimura & Aviv 2011 Aubert, Hills & Lansdorp 2012). Die Schlüsselstadien des TRF-Prozesses sind (i) Restriktionsenzymverdau von gDNA, (ii) Agarosegelelektrophorese der verdauten DNA, (iii) Hybridisierung unter Verwendung von entweder traditionellen denaturierenden Blots oder nicht denaturierenden In-Gel-Hybridisierungstechniken und ( iv) Bildanalyse von Telomerabstrichen auf den resultierenden Gelen, um Abschätzungen der Telomerlänge zu erzeugen. TRF ist eine technisch anspruchsvolle Methode und erfordert relativ hohe DNA-Konzentrationen, ein hohes Maß an Know-how und Investitionen zum Aufbau eines neuen Labors und ist selbst in Expertenhänden nur mit geringem Durchsatz möglich. Es hat jedoch viele Vorteile, einschließlich der Bereitstellung einer leicht quantifizierbaren Verteilung von TLs in kb-Einheiten, die über Populationen und Arten hinweg verglichen und zur Schätzung von Mittelwert, Median und Varianz in TLs innerhalb einer Zellprobe verwendet werden kann (Tabelle 1). Es gibt eine enorme Variabilität der Telomerlängen zwischen den Taxa (Gomes, Shay & Wright 2010b). Der wahrscheinliche obere und untere Bereich der TLs einer Studienart ist eine besonders wichtige Überlegung bei der Verwendung der TRF-Methode, wie wir weiter unten ausführlicher diskutieren. Wir diskutieren auch die relativen Vorteile der denaturierenden Gel- und In-Gel-Hybridisierungsmethoden weiter unten und empfehlen die Lektüre von Kimura et al. ( 2010b ) für vollständige methodische Details des ersteren und Haussmann & Mauck ( 2008 ) für letzteres.

Der erste Schritt bei TRF ist der Restriktionsverdau der extrahierten gDNA. Die meisten Studien, die TRF-Methoden verwenden, verwenden mehrere der verfügbaren geeigneten Restriktionsenzyme (einschließlich HinfI, RsaICH, HaeIII und MspI) mit der kombinierten Verwendung von just HinfIch und RsaIch bin besonders häufig (siehe Delany, Krupkin & Miller 2000 Haussmann & Mauck 2008 Kimura et al. 2010b für weitere Informationen). Es ist wichtig, alle Proben mit der gleichen Kombination zu verdauen und die gewählten Restriktionsenzyme während der Analyse nicht zu verändern. Die verdaute DNA wird dann unter Verwendung von Agarosegelelektrophorese aufgetrennt. Es ist wichtig, die DNA-Konzentrationen zu standardisieren, bevor die Proben auf das Gel geladen werden Kimura® et al. ( 2010b ) haben eine Standardisierung auf den Bereich 300–500 ng μl −1 empfohlen. Da die TRF-Analyse vollständig von der Position der Telomersequenz innerhalb eines Gels abhängt, sollten geeignete Schritte unternommen werden, damit Gelinkonsistenzen sowohl innerhalb als auch zwischen Gelen diagnostiziert werden können. Innerhalb eines Gels sollte der Molekulargewichtsmarker gleichmäßig in 5–10 Vertiefungen über das Gel verteilt sein, um eine konsistente DNA-Migration in allen Teilen des Gels zu gewährleisten (Kimura et al. 2010b). Darüber hinaus ermöglicht das mehrmalige Laden derselben Probe innerhalb und zwischen den Gelen die Bewertung und Berichterstattung der Intra- und Interassay-Variabilität (Kimura et al. 2010b). Je nach dem in der untersuchten Spezies gefundenen Telomerbereich werden unterschiedliche Arten der Gelelektrophorese empfohlen. Wo TL typischerweise <20 kb ist, bietet die Konstantfeld-Gelelektrophorese (CFGE) eine gute Auflösung (Haussmann & Mauck 2008) und wurde typischerweise in Studien am Menschen verwendet (Kimura et al. 2010b). Wo TLs typischerweise >20 kb sind, kann eine Pulsfeld-Gelelektrophorese (PFGE) verwendet werden, um eine bessere Auflösung großer DNA-Fragmente bis zu 10 Mb bereitzustellen (Haussmann & Mauck 2008). Welche Methode auch immer verwendet wird, es ist sehr hilfreich, die wichtigsten elektrophoretischen Parameter anzugeben, die in den Methoden jeder Veröffentlichung unter Verwendung von TRF verwendet werden (z. Kimura et al. ( 2010b ) geben auch Hinweise zum Anteil von Agarosegel, der sich am besten für die Analyse von Telomeren unterschiedlicher Länge eignet.

Nach der Gelelektrophorese wird dann eine Hybridisierung unter Verwendung einer Telomersonde durchgeführt, die komplementär zu den Telomersequenzwiederholungen (CCCTAAn oder TTAGGGn) ist und entweder mit Chemikalien für den Chemilumineszenznachweis (z. B. Digoxigenin) oder Radiochemikalien für den radioaktiven Nachweis (z. B. 32P) markiert ist. Ob eine Denaturierung auf einem nicht denaturierenden Gel verwendet wird, beeinflusst die Sondenbindung, und es ist sehr wichtig, dass die Sonde nach der Auswahl nicht innerhalb einer Studie gewechselt wird. Radioaktive Sonden erhöhen die Nachweisempfindlichkeit, erfordern aber auch mehr Sicherheitsvorkehrungen (Kimura et al. 2010b). Gegenwärtig werden denaturierende Blots häufig in humanen TL-Studien verwendet. In einem denaturierenden Blot werden die elektrophoretisch aufgetrennten DNA-Fragmente auf eine Hybridisierungsmembran übertragen. Die doppelsträngige DNA wird dabei denaturiert, sodass die Sonde an alle Telomersequenzen im TRF binden kann.Bei dieser Methode binden längere Telomere mehr Sonde, daher muss dies während der Analyse korrigiert werden (Kimura et al. 2010b). Beim In-Gel-Hybridisierungsansatz wird das Gel getrocknet und dann direkt untersucht, anstatt DNA-Fragmente auf eine Hybridisierungsmembran zu übertragen (Haussmann & Mauck 2008). Das Ergebnis ist, dass Telomersequenzen nicht denaturiert werden, so dass nur die CCCTAAn-Sonde an den Telomer-Einzelstrangüberhang bindet (Haussmann & Vleck 2002). Der große Vorteil der In-Gel-Technik besteht darin, dass sie nur terminale Telomere bindet (dh sie bindet keine vorhandenen interstitiellen Telomersequenzen, siehe Abschnitt „Welche Methode ist zu wählen…“ weiter unten), aber das hat ihren Preis von weniger gebundener Sonde und die Möglichkeit einer verringerten Empfindlichkeit. Unabhängig davon, welches verwendet wird, ist es wichtig, die Membran oder das Gel ausreichend zu waschen, um die unspezifische Bindung der Sonde zu reduzieren, die während der TRF-Analyse zu einem Hintergrund führt (Kimura et al. 2010b).

Nachdem die Membran oder das Gel auf einem Röntgenfilm oder einem Leuchtstoffschirm belichtet wurde, wurden verschiedene Ansätze verwendet, um TLs aus dem resultierenden Bild zu quantifizieren. Im Allgemeinen erfolgt die TRF-Messung durch Abschätzen der Telomerfragmentgröße durch Vergleich mit Molekulargewichtsmarkern auf dem Gel und Beziehen dieser mit den optischen Dichten (OD) entlang des Telomerabstrichs in jeder Spur (Kimura et al. 2010b Haussmann, Salomons & Verhulst 2011). Die Gewinnung von OD-Daten aus Telomerbildern ist keine triviale Aufgabe. Es sind zahlreiche Aspekte zu berücksichtigen, darunter ob und wann Bahnen von Analysen ausgeschlossen werden sollen, welche Software verwendet werden soll, um OD-Werte aus einem Gelbild zu erhalten, wie eine Hintergrund-OD ausgewählt wird, um von Bahn- oder Gel-ODs zu subtrahieren, und das zu verwendende Analysefenster um die TL-Verteilung zu berechnen. Verschiedene Laboratorien haben in jeder Hinsicht unterschiedliche Methoden verwendet, und hier ist es entscheidend, die Methode in jeder Veröffentlichung vollständig zu erklären und während einer Studie vollständig mit der Methode zu übereinstimmen. In der neueren Literatur (Horn, Robertson & Gemmell 2010) gab es einige Diskussionen über die Verwendung des Programms 'Telometric' zur Analyse von Gelen, und nun wurde eine vollständige Beschreibung der Probleme mit dieser Software vorgelegt (Haussmann, Salomons & Verhulst 2011). Unser Konsens ist, dass aufgrund des Potenzials für Bias in seinen Berechnungsmethoden das Telometrie in seiner derzeitigen Form nicht zur Analyse von TRF-Gelen verwendet werden sollte. Eine kostenlos herunterladbare Bildanalysesoftware wie imagej (National Institute for Health, Bethesda, MA, USA) kann verwendet werden, um die OD-Variation über Gelbilder abzuschätzen, aber weitere Analysen dieser Daten müssen von den Forschern selbst durchgeführt werden . Für ein funktionierendes Beispiel einer solchen Analyse verweisen wir den Leser auf den Online-Anhang von Haussmann, Salomons & Verhulst ( 2011 ). Die am besten geeignete Methode für eine bestimmte Studie oder einen bestimmten Geltyp kann von der Fragestellung und dem Studiensystem abhängen, und jeder Forscher sollte daher in jedem veröffentlichten Artikel seinen Ansatz zur Analyse von TRF-Gelen entwickeln, begründen und vollständig erläutern.

QPCR-Assay

Die qPCR-basierte Methode zur Messung von TL wurde von Richard Cawthon teilweise entwickelt, um das Problem zu überwinden, dass die mit der TRF-Methode gemessene TL je nach den verwendeten Restriktionsenzymen und aufgrund der Grenzen, die die DNA-Menge und die Zeit, die für die Messung erforderlich sind, etwas variieren kann der TRF-Assay kann auf praktikable Probengrößen gesetzt werden (Cawthon 2002, 2009). Im Gegensatz zu TRF, die eine Schätzung des Durchschnitts oder des Bereichs von TLs in kb in der Zellprobe liefert, liefert qPCR eine Schätzung der Menge der in der Probe vorhandenen Telomersequenz im Verhältnis zur Menge einer spezifizierten nicht-telomeren Referenzsequenz, die ist autosomal und in der Kopienzahl nicht variabel (Cawthon 2002). qPCR ist die zeiteffizienteste und derzeit verfügbare Hochdurchsatzmethode und erfordert weniger DNA als TRF (Tabelle 1), was wichtig ist, wenn DNA aus kleinen Mengen von Gewebe oder Vollblut extrahiert wird oder wenn Blutproben von Spezies ohne kernhaltige Erythrozyten verwendet werden. Für die qPCR-Optimierung und um die Zielspezifität und die Assay-Präzision zu gewährleisten, sind jedoch weiterhin Fachwissen, Sorgfalt und qualitativ hochwertige DNA erforderlich. Viele der allgemeinen Ratschläge zur Genexpression und qPCR-Analyse, z. B. zur Primerauswahl und -optimierung (z et al. 2009 ) ist für den Telomer-qPCR-Assay gleichermaßen relevant und sollte konsultiert werden, bevor versucht wird, diese Assays zu entwickeln. Wichtige Schritte bei der Entwicklung und Validierung eines qPCR-Telomer-Assays umfassen: (i) Identifizierung einer geeigneten Gensequenz mit nicht variabler Kopienzahl (ii) Überprüfung der Amplifikationseffizienz und Schmelzkurvenspezifität sowohl des Gens mit nicht variabler Kopienzahl als auch der Telomersequenz während der qPCR (iii) Feststellung einer hohen Wiederholbarkeit des Assays innerhalb und zwischen den Platten.

Der qPCR-Assay folgt dem allgemeinen Prinzip der Polymerase-Kettenreaktion (PCR), bei der DNA als Matrize für ihre eigene Amplifikation fungiert. Die exponentielle Natur der PCR bedeutet, dass die Anzahl der thermischen Zyklen (Cq) erforderlich ist, um die Produktamplifikation (gemessen durch einen interkalierenden Farbstoff wie SYBR green, der fluoresziert, wenn er an die neu erzeugte doppelsträngige DNA gebunden wird) einen Satz zu durchqueren Der Schwellenwert in der exponentiellen Wachstumsphase (Nq) ist proportional zur Menge der ursprünglichen Template-DNA. Im Telomer-Assay gibt es zwei Ziele für die Amplifikation: die Telomersequenz (T) und die Gensequenz mit nicht variabler Kopienzahl (N). Cawthon (2002) bezeichnete diese ursprünglich als T und S (für Einzelkopie-Gen) und nicht als N, aber tatsächlich muss die Referenzsequenz nicht in Einzelkopie oder als Teil eines Gens vorliegen (Smith, Turbill & Penn 2011). Dieses Gen mit nicht variabler Kopienzahl wird verwendet, um der Tatsache Rechnung zu tragen, dass die Anzahl der Zellen unterschiedlich sein wird, auch wenn der Forscher versucht, dieselbe DNA-Konzentration in jeder Reaktion zu verwenden. Solange die N-Sequenz in jedem in den Proben vertretenen Genom identisch vertreten ist, wird sie diese Funktion erfüllen. Die Konservierung der Telomersequenz bedeutet, dass die T-Primer (tel 1 und tel 2), die ursprünglich von Cawthon (2002) entworfen und dann für eine höhere Effizienz modifiziert wurden (tel 1b und tel 2b) von Epel et al. 2004 sollte bei allen Wirbeltieren funktionieren. Es muss jedoch eine geeignete N-Sequenz identifiziert und Primer für die Sequenzierung entworfen werden de novo für jede neue Studienart. Wichtig ist, dass, selbst wenn ein potenzielles N-Gen, das in allen Tieren gefunden wurde, zuvor verwendet wurde, die Sequenz- und Kopienzahl sogar zwischen eng verwandten Arten variieren kann. Eine Methode zur Auswahl einer Gensequenz mit nicht variabler Kopienzahl besteht darin, 3–5 Kandidatensequenzen an einer Reihe von Proben zu testen, die beide Geschlechter und alle im endgültigen Probensatz verwendeten Populationen repräsentieren, und auf Kopienzahlvariation oder fehlende Amplifikationsspezifität zu prüfen (wie beschrieben in Smith, Turbill & Penn 2011).

Wenn die T- und N-Sequenzen unter den gleichen PCR-Bedingungen amplifiziert werden, sollten die Reaktionen auf derselben Platte durchgeführt werden, da die Normalisierung innerhalb der Platte die Wiederholbarkeit zwischen den Platten erhöhen kann (Barrett et al. 2012). Darüber hinaus ist in der Regel auf jeder Platte eine Referenzprobe (oder „goldene“) Probe enthalten, und T:N-Verhältnisse werden relativ zu denen der Plattenreferenzprobe dargestellt, wodurch die Variation zwischen den Platten berücksichtigt wird (Cawthon 2002). Diese Referenzproben können aus einer großvolumigen Einzelprobe entnommen oder aus mehreren Proben gepoolt werden, um sicherzustellen, dass genug für alle geplanten Assays vorhanden ist, und sollten in mehreren kleinvolumigen Einmal-Aliquots eingefroren aufbewahrt werden, um ein wiederholtes Einfrieren und Auftauen zu verhindern, das die Reaktionseffizienz beeinflussen. Es wird empfohlen, sowohl die T- als auch die N-Amplifikation für jede Probe dreifach durchzuführen. Der Mittelwert über die Replikate kann dann verwendet werden (z. B. Barrett et al. 2012 ), obwohl wir nachdrücklich dafür plädieren, den Messfehler zwischen den Replikaten zu berechnen und anzugeben. Kürzlich hat Cawthon ( 2009 ) einen monochromen Multiplex-qPCR-Ansatz vorgeschlagen, der prinzipiell einen geringeren Messfehler und einen erhöhten Durchsatz bietet. Bis heute wurde diese Methode außerhalb von Studien am Menschen nicht weit verbreitet angewendet, obwohl sie in zwei neueren Studien bei Milchkühen angewendet wurde (Brown et al. 2012 ) und Buckelwale (Olsen et al. 2012 ) ohne Validierung gegen eine Nicht-qPCR-Methode. Ein Vorteil besteht darin, dass das Verfahren die Berechnung einer relativen TL für jedes Well ermöglicht. Anstatt also einfach über Probenreplikate innerhalb einer Platte zu mitteln und dabei den Messfehler zu ignorieren, der mit der Variation zwischen den Replikaten verbunden ist, kann diese Variation in nachfolgende Analysen einbezogen und berücksichtigt werden, zum Beispiel in einem Modell mit gemischten Effekten (siehe Brown et al. 2012 zur Veranschaulichung).

Für präzise und reproduzierbare Daten müssen sowohl für die T- als auch für die N-Amplikons eine spezifische Amplifikation und hohe Amplifikationseffizienzen erreicht werden. Die Amplifikationsspezifität kann durch Analysieren der Derivat-Schmelzkurve bestimmt werden, die einen einzelnen Peak für jedes der T- und N-Sequenz-Amplikons zeigen sollte. Mehrere Peaks weisen auf unspezifische Amplifikation und Primer-Dimer-Bildung hin, die aus einer schlechten Primer-Selektion und/oder PCR-Optimierung resultieren können (Bustin et al. 2009). Die Amplifikationseffizienz ist die relative Zunahme der Amplikon-Konzentration pro Zyklus, wobei die Verdopplung einer Effizienz von 100 % entspricht. Die Effizienz kann pro Amplikon unter Verwendung von Standardkurven (Pfaffl 2001 ) oder durch Anpassen von Regressionen an die loglineare Phase einzelner Reaktionen (Ruijter et al. 2009). Die Effizienzen zwischen T und N unterscheiden sich normalerweise, und kleine Fehler bei der Effizienzschätzung werden exponentiell zu sehr großen Fehlern bei Berechnungen der anfänglichen Sequenzgröße addiert 'Delta-Delta-Methode', die in Cawthons Artikel von 2002 verwendet wurde). Wir befürworten eine Methode, die anfänglich die Basislinienvariation der Fluoreszenz subtrahiert, da dies die geschätzten Effizienzen verzerren und die Variation zwischen den Platten erhöhen kann (Ruijter et al. 2009 ) und berücksichtigt dann auch Effizienzunterschiede zwischen den Stichproben (z. B. Pfaffl 2001 ). Das Freeware-Programm LinRegPCR ist in der Lage, solche Berechnungen mit Rohdaten verschiedener qPCR-Plattformen (Ruijter et al. 2009 ), ebenso wie andere im Handel erhältliche Programme. Es wurden verschiedene Methoden verwendet, um die relative TL aus den Cq- und Effizienzdaten zu berechnen, die von Softwarepaketen (z. B. Barrett et al. 2012 Olsen et al. 2012 Turbill et al. 2012). Diese scheinen eng korrelierte Ergebnisse zu erzeugen (Olsen et al. 2012 ), aber es ist wichtig, in jeder Veröffentlichung die genaue Methode anzugeben.

Ein Hauptnachteil des relativen qPCR-Telomer-Assays besteht darin, dass er einen relativen Wert der Telomersequenz pro Genom innerhalb der Studie liefert und nicht eine durchschnittliche Telomerlänge in kb. Als solches kann es nicht verwendet werden, um die TL- oder Telomerdynamik zwischen Studien, Populationen oder Arten zu vergleichen. O'Callaghan et al. 2008 adaptierte den relativen qPCR-Telomer-Assay durch Vergleich der Probenamplifikation mit der von synthetisierten Telomer-Oligomeren bekannter Länge, um eine geschätzte TL in kb pro diploider Genomskala zu erhalten (die „absolute qPCR“-Methode O'Callaghan et al. 2008). Ob dieser Ansatz einen Vergleich zwischen Studien sinnvoll macht, ist derzeit umstritten. Die Methode wurde kritisiert, weil sie unrealistische Schätzungen der Telomerlänge liefert, was darauf hindeutet, dass dies an Effizienzunterschieden zwischen Proben und den externen Oligomerreferenzen liegen könnte (Horn, Robertson & Gemmell 2010). Barrett et al. ( 2012 ) modifizierten die Methode, um Unterschiede in der Effizienz zwischen Proben und Oligomeren zu berücksichtigen. Die relativen und absoluten Ergebnisse waren fast perfekt korreliert, vermutlich weil die absolute Methode kaum mehr tut, als die ursprünglichen relativen TL-Daten neu zu skalieren (z. R = 0·99, Barrett et al. 2012). Bevor die Verwendung absoluter qPCR-Daten in Vergleichsstudien in Betracht gezogen wird, ist es nach wie vor entscheidend, absolute qPCR-basierte TL-Schätzungen zu validieren, indem man die Unterschiede zwischen Studien, Individuen oder Spezies mit denen vergleicht, die mit einer direkteren TL-Messmethode wie TRF oder Flow-Fluoreszenz erhalten wurden vor Ort Hybridisierung (FISH), um sicherzustellen, dass die gemessene Variation die Variation in der Menge der Telomersequenz an den Chromosomenenden widerspiegelt.

Q-FISH und Flow-FISH

Inzwischen sind vier verschiedene Protokolle zur Messung der Telomerlänge (TL) dokumentiert, die FISH verwenden (Aubert, Hills & Lansdorp 2012). Sie alle sind Adaptionen der ursprünglichen Methode, quantitativer FISH (Q-FISH), die von Lansdorp (Lansdorp et al. 1996). Q-FISH ist ein leistungsfähiges, aber technisch anspruchsvolles Verfahren. Es erfordert kultivierte Zellen oder fixierte Gewebeschnitte. Dann mit einer fluoreszenzmarkierten Peptidnukleinsäure (PNA)-Sonde (CCCTAA)3, das spezifisch an denaturierte Telomer-DNA hybridisiert, kann die TL jedes Chromosomenendes gemessen werden. Die Fluoreszenzintensität der gebundenen Sonde ist direkt proportional zu TL. Diese quantitative Beziehung ist die Grundlage aller FISH-Protokolle zur Messung von TL. Bei Q-FISH erstellen ein Fluoreszenzmikroskop und eine empfindliche CCD-Kamera digitale Bilder von Metaphase-Spreads und werden mit einer speziellen Software analysiert. Die Telomerintensitäten werden auf Proben oder Standards bekannter TL (Poon et al. 1999). Wenn in der Metaphase arretierte Zellen verwendet werden, liefert Q-FISH quantitative Informationen über die TL-Verteilungen innerhalb einer Probe und kann kritisch kurze Telomere erkennen. Wenn fixierte Gewebeproben verwendet werden, liefert Q-FISH Informationen über die durchschnittliche Telomerlänge. Diese Information ist in Humanstudien von großer Bedeutung, da gezeigt wurde, dass die Akkumulation kritisch kurzer Telomere anstelle von kurzen durchschnittlichen TL genetische Instabilität verursacht, das Überleben von Zellen und die Gewebeerneuerung begrenzt (Hemann et al. 2001 Hao et al. 2005). Diese Technik bietet die Möglichkeit, Telomere einzelner Chromosomen getrennt zu analysieren, einschließlich der Differenzierung zwischen p- und q-Armen von Schwesterchromatiden (was 4 Telomermessungen pro Chromosom ergibt). Es ermöglicht auch die gleichzeitige Karyotypisierung und Identifizierung von Chromosomenanomalien wie End-to-End-Fusionen (Lansdorp et al. 1996 Poon et al. 1999 ).

Q-FISH erreicht eine hohe Auflösung, ist jedoch arbeitsintensiv, zeitaufwendig und erfordert lebensfähige Zellproben oder fixierte Gewebeschnitte (Tabelle 1). Flow-FISH wurde entwickelt, um einige dieser Einschränkungen zu überwinden, und wird heute häufig in Studien zur menschlichen LTL-Dynamik verwendet (Aubert & Lansdorp 2008 Aubert, Hills & Lansdorp 2012). Hier werden Interphase-Zellen in Suspension mit einer PNA-Telomer-spezifischen Sonde hybridisiert und die durchschnittliche TL anhand der Fluoreszenzintensität mittels Durchflusszytometrie (Rufer et al. 1998). Diese Technik ermöglicht die Analyse einer größeren Anzahl von Zellen in viel kürzerer Zeit. Mittels Antikörperfärbung können verschiedene Zelltypen innerhalb einer Blutprobe sortiert und verglichen werden. Allerdings müssen Blutproben frisch sein, und das Verfahren erfordert noch erhebliche Fachkenntnisse (Tabelle 1). Angesichts der Komplexität und Spezialisierung von FISH-Protokollen überrascht es nicht, dass sie von Forschern, die TL in Nicht-Modellorganismen messen möchten, selten verwendet werden. Der Zugang zu grundlegenden Laboreinrichtungen kann bei der Probenahme von Wildpopulationen, manchmal an abgelegenen Orten, eingeschränkt sein, sodass dies höchstwahrscheinlich für Laborstudien mit in Gefangenschaft gehaltenen Tieren nützlich ist oder lebensfähige Zellkulturen leicht aus entnommenen Gewebeproben hergestellt werden können. Die Möglichkeit, lebende Zellen zu entnehmen oder zu kultivieren, ist ebenso wie die dedizierte und oft teure Laborausrüstung grundlegende Voraussetzungen für FISH-Techniken. Die Fähigkeit, die Telomerdynamik in Nicht-Modellorganismen auf dieser tiefen Ebene zu studieren, könnte jedoch unser Verständnis der Wechselwirkungen zwischen biologischem Zustand und Lebensgeschichte enorm beschleunigen.

Einzeltelomerlängenanalyse

Die Einzeltelomerlängenanalyse (STELA) ist ein hochauflösender Einzelmolekül-PCR-basierter Ansatz zur Bestimmung der Telomerlänge (Baird et al. 2003). STELA zielt auf spezifische Chromosomenenden ab, für die eine telomer-benachbarte Sequenz verfügbar ist. Ursprünglich für die Analyse des humanen XpYp-Telomers entwickelt, wurde STELA nun auf mehrere zusätzliche humane Chromosomenenden erweitert und für die Verwendung in Caenorhabditis elegans (Cheung et al. 2004 Britt-Compton et al. 2006). STELA nutzt die einzigartige Struktur des 3'-G-reichen Überhangs am Telomer-Terminus: Ein Linker (Telorette) bindet an diese Sequenz und wird an das Ende des C-reichen Strangs ligiert. Dann wird eine Long-Range-PCR verwendet, um zwischen einem spezifischen Telomer-benachbarten PCR-Primer und einem zweiten Primer (Teltail) zu amplifizieren, der aus der Sequenz des 5'-Endes des Telorette-Linkers besteht. Die PCRs werden auf Einzelmolekülebene mit einer Amplifikation von typischerweise 6–10 amplifizierbaren Molekülen pro Reaktion durchgeführt, jede Probe wird mit bis zu sechs separaten Reaktionen analysiert, um eine ausreichend große Probengröße bereitzustellen. Die amplifizierten Telomermoleküle werden durch Southern-Hybridisierung mit Telomer-benachbarten und Telomer-Repeat enthaltenden Hybridisierungssonden nachgewiesen. Dieser Einzelmolekül-Ansatz ergibt ein Bandenmuster, wobei jede Bande die Telomerlänge eines einzelnen Eingangstelomers repräsentiert.

STELA benötigt nur geringe Mengen an zugeführter DNA, beim Menschen werden typischerweise <2 ng DNA pro Probe analysiert. Der entscheidende Vorteil dieses Ansatzes besteht jedoch darin, dass die kürzesten Telomere leicht nachweisbar sind, tatsächlich können Telomere, die aus einem einzelnen doppelsträngigen Telomer-Repeat bestehen, nachgewiesen werden Telomere in diesen Längenbereichen sind derzeit mit keiner anderen Methode nachweisbar. Diese kurzen Telomere sind biologisch wichtig, da sie in seneszenten Zellen, in Zellen in einer Krebskrise und nach sporadischer Telomerdeletion (Baird .) beobachtet werden et al. 2003 Baird 2008 Lin et al. 2010). Vorausgesetzt, die längsten Telomere liegen innerhalb des durch PCR amplifizierbaren Längenbereichs von bis zu 25 kb, kann mit STELA das gesamte Spektrum der Telomerlängen nachgewiesen werden. Viele Organismen enthalten komplexe subtelomere Wiederholungssequenzstrukturen und interstitielle Telomerwiederholungen, die die Interpretation von TRF-, Q-FISH- und Q-PCR-basierten Ansätzen durcheinander bringen können. Durch die Reduzierung der Komplexität und die Analyse spezifischer Chromosomenenden könnte STELA diese Probleme prinzipiell vermeiden. Der Erfolg von STELA hängt jedoch von der Existenz einer einzigartigen, an Telomere angrenzenden Sequenz ab, und das Fehlen dieser Sequenzen ist wahrscheinlich der Schlüsselfaktor, der STELA für die Verwendung in zusätzlichen Organismen einschränkt. An Telomere angrenzende Sequenzen sind nicht einfach zu charakterisieren und werden in Genomsequenzierungsprojekten oft nicht repräsentiert, tatsächlich müssen viele dieser Regionen des menschlichen Genoms noch vollständig charakterisiert werden (Riethman 2008).Es wurden jedoch einfache PCR-basierte Strategien verwendet, um telomer-benachbarte Sequenzen beim Menschen und verwandten Spezies zu charakterisieren (Royle, Hill & Jeffreys 1992 Royle, Baird & Jeffreys 1994 Baird & Royle 1997), und diese Ansätze könnten verwendet werden, um genügend Telomere zu charakterisieren -benachbarte Sequenzen für STELA in Organismen mit schlecht charakterisierter genomischer Sequenz.

Der Dot-Blot-Telomer-Assay

Welche Methode soll man wählen und ist eine Methode ausreichend?

Obwohl die qPCR-Methoden aufgrund ihrer kurzen Zeit und Kosten sehr attraktiv sind, bleibt die Variabilität innerhalb und zwischen den Proben relativ hoch. Jedes Labor, das eine qPCR-Methode anwendet, sollte daher eine Erstkalibrierung auf eine nicht-PCR-basierte Telomerlängenmessung durchführen und die Technik bis zu einem hohen R 2 Koeffizient wird erreicht (Aubert, Hills & Lansdorp 2012 ).

Bisher haben Studien TRF- und qPCR-Methoden bei Menschen und Vögeln verglichen und starke Korrelationen zwischen den resultierenden Schätzungen der durchschnittlichen TL gefunden (z. B. Criscuolo et al. 2009 Aviv et al. 2011 Angelier et al. 2013). Eine wachsende Zahl veröffentlichter Studien mit qPCR bei nicht-menschlichen Tieren hat jedoch ihre qPCR-Methodik nicht gegen TRF validiert. Wir sind der Meinung, dass die qPCR-Methode intern validiert und allein verwendet werden kann, solange: (i) vollständige methodische Details vorgelegt werden, einschließlich vollständiger Beschreibungen, wie Amplifikationsspezifitäten und -effizienzen bestimmt und in der Qualitätskontrolle und Berechnungen von TL verwendet wurden, ( ii) kann eine hohe Wiederholbarkeit innerhalb und zwischen den Platten nachgewiesen werden, und (iii) Analysen und Interpretationen gehen nicht über die relativen Unterschiede der TL zwischen den Proben in der spezifischen Studie oder dem Experiment hinaus. Abgesehen davon, dass Forscher mehr als eine Waffe in ihrem methodischen Arsenal haben möchten, gibt es jedoch andere wichtige Gründe als die bloße Herstellung von methodenübergreifenden Korrelationen. Obwohl die qPCR in der Lage ist, schnell große Datensätze zu generieren, bietet sie im Vergleich zu einigen anderen verfügbaren Methoden nur ein schmales Fenster zur Telomerdynamik. Es schätzt den durchschnittlichen genomischen Telomer-Sequenzgehalt und erfasst nicht die Variation in TL, die in einer Probe vorhanden ist, die alle anderen Verfahren außer der Dot-Blot-Technik in irgendeiner Form bereitstellen (Tabelle 1). Immer mehr Beweise weisen auf wichtige Verbindungen zwischen der Reichweite von TLs und der Zellfunktion hin, insbesondere auf das Vorhandensein kritisch kurzer TLs (Hemann et al. 2001). Tatsächlich liefert eine kürzlich durchgeführte Studie mit einer Hochdurchsatzadaption der Q-FISH-Methode den ersten Zusammenhang zwischen einer Zunahme der Anzahl sehr kurzer Telomere und dem Überleben bei Labormäusen (Vera et al. 2012). Es kann sich letztendlich als sehr wichtig erweisen, über die qPCR-Methodik hinauszugehen, wenn wir die Bedeutung der Variation in der TL oder das Vorhandensein sehr kurzer Telomere ansprechen wollen. Obwohl andere Techniken als qPCR und TRF einen erheblichen zusätzlichen Zeit- und Kostenaufwand für die Einrichtung und Validierung erfordern können, ist es außerdem wichtig, die zusätzlichen Erkenntnisse zu schätzen, die solche Techniken bieten könnten. STELA könnte zum Beispiel wichtige Erkenntnisse über die Bedeutung kritisch kurzer Telomere für die Funktion und Fitness des gesamten Organismus liefern, während Flow-FISH ein Mittel zur Analyse von Ähnlichkeiten und Unterschieden in der Telomerdynamik zwischen verschiedenen Arten von Blutzellen bieten könnte.

Eine weitere Überlegung bei der Auswahl einer Telomer-Messtechnik und der Interpretation ihrer Ergebnisse ist das Vorhandensein von interstitiellen Telomer-Wiederholungen, die in den Chromosomen einiger Organismen, einschließlich vieler Vögel und Säugetiere, gefunden werden (Delany, Krupkin & Miller 2000 Ruiz-Herrera et al. 2009). Messungen unter Verwendung der qPCR-, Dot-Blot- und denaturierenden TRF-Methoden umfassen sowohl terminale als auch interstitielle Telomersequenzen (Tabelle 1). Nicht-denaturierende In-Gel-Hybridisierungs-TRF-Methoden messen nur terminale Sequenzen, ebenso wie STELA- und FISH-Techniken. Bemerkenswert ist, dass eine kürzlich durchgeführte kleine Studie an mehreren Sperlingsvögeln die sequentielle Anwendung von nicht denaturierenden und denaturierenden TRF-Gelen verwendet, um die relative Menge der vorhandenen interstitiellen Telomersequenz abzuleiten (Foote, Vleck & Vleck 2013). Die Ergebnisse deuten darauf hin, dass Variationen des interstitiellen Telomersignals bei Spezies, zwischen und innerhalb von Individuen vorhanden sein können und Rauschen zu TL-Daten hinzufügen können, was es möglicherweise schwieriger macht, Muster zu finden. Wie sich dieser Befund jedoch auf andere Arten verallgemeinern lässt oder die dafür verantwortlichen Mechanismen der offensichtlichen Variation der interstitiellen Telomersequenz sind derzeit unklar (Foote, Vleck & Vleck 2013).


Materialen und Methoden

Zellkultur und Kryokonservierung

Humane Knochenmark-CD34+-hämatopoetische Stamm-/Vorläuferzellen wurden von AllCells und Fred Hutchinson Cancer Research Center erhalten. CD34 + -Zellen wurden in StemSpan SFEM II-Medium, ergänzt mit CC110 (StemCell Technologies), gehalten. K562-Zellen wurden in IMDM, ergänzt mit 10 % FBS und 1 % Penicillin/Streptomycin, kultiviert. Gefrorene Stammlösungen wurden mit 10 % DMSO und 30 % FBS in K562-Medium hergestellt und vor der Verwendung in flüssigem Stickstoff gelagert. Genome Editing Experimente in hESCs wurden wie zuvor beschrieben durchgeführt (Hockemeyer et al., 2009 Soldat et al., 2009 Hockemeyer et al., 2011 ) in der WIBR#3-Linie (Lengner et al., 2010 ) und NIH-Stammzellregister # 0079. Die Zellkultur wurde wie zuvor in Boyle . beschrieben durchgeführt et al ( 2020 ).

Anleitung zum RNA-Design und -Präparation

  • AAVS1-sgRNA-1-Oligo: ggatcctaatacgactcactataggCCGGCCCTGGGAATATAAGGgttttagagctagaa
  • POT1-sgRNA1-Oligo: ggatcctaatacgactcactatagGAGATCTTGCCACATGAACAgttttagagctagaa
  • POT1-sgRNA2-Oligo: ggatcctaatacgactcactatagGTGATTTAAGTCACATCCATgttttagagctagaa
  • (sgRNA-Sequenzen sind in Großbuchstaben)
  • T7RevLong: AAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC
  • T7FwdAMP: GGATCCTAATACGACTCACTATAG
  • T7RevAMP: AAAAAAGCACCGACTCGG
  • POT1 Y223C zum Einsetzen der PGK-Puro-pA-Kassette: GAGATCTTGCCACATGAACA
  • POT1 Y223C zielt auf die Beseitigung von Arzneimittelresistenzen ab über de novo Protospacer-Advanced-Motive (PAM)-Sites: GAGATCTTGCCACATGACCA und GTCTGCGATAATCATGTCCA
  • POT1 Q623H: GATTACATCTTCTGCAACTG

Elektroporation zur Genom-Editierung

Die Genom-Editierung durch Elektroporation unter Verwendung des Lonza 4D-Nukleofectors wurde wie im Protokoll des Herstellers (Lonza, Inc.) beschrieben durchgeführt. Um sgRNA in K562 zu validieren, wurden ungefähr 200.000 Zellen pelletiert und in 20 µl Lonza SF Puffer mit Ergänzungslösung resuspendiert. Der RNP-Komplex wurde durch langsame Zugabe von 60 pmol synthetisierter sgRNA zu 100 pmol gereinigtem CAS9-Protein in CAS9-Puffer hergestellt. Der RNP-Komplex wurde 20 min bei Raumtemperatur inkubiert und zur Zellsuspension gegeben. Um hCD34 + -Zellen zu editieren, wurden 1 Million Zellen in 100 &mgr;l Lonza P3-Puffer, der eine Ergänzungslösung enthielt, resuspendiert. Der RNP-Komplex wurde mit 300 pmol synthetisierter sgRNA und 500 pmol gereinigtem CAS9-Puffer wie oben beschrieben hergestellt. Die Elektroporation von K562 und hCD34 + wurde unter Verwendung eines K562-spezifischen Programms bzw. des Programms ER100 durchgeführt.

Für die „narbenlose“ Genom-Editierung in hESCs wurden Zellen zunächst mit einem sgRNA-exprimierenden Plasmid (pX330), das auf POT1 abzielt, und einem Donorplasmid co-elektroporiert. Das Donorplasmid enthielt eine PGK-Puro-pA-Kassette flankiert von de novo NcoI-Stellen und die Y223C-Mutation in einem der Homologiearme. Nach 10-tägiger Selektion mit Puromycin wurden aus Einzelzellen stammende Kolonien isoliert, Replikate ausplattiert und genomische DNA zur Bestätigung der Genotypen isoliert. Der „narbenlose Loopout“ von korrekt auf Puro gerichteten Klonen wurde in einem nachfolgenden zweiten Schritt durch Co-Elektroporation eines GFP-Expressionsplasmids (N2-GFP) mit zwei px330 sgRNA-exprimierenden Plasmiden durchgeführt, die auf die zwei einzigartigen PAM-Sequenzen abzielten, die von den NcoI-Stellen erzeugt wurden. Die Zellen wurden nach GFP-Expression einzelzellsortiert und Kolonien wurden isoliert und genotypisiert, um die Entfernung der Puromycin-Kassette zu bestätigen, während die Mutation (Y223C) zurückgelassen wurde. Das Targeting wurde zuerst durch PCR und dann durch Sanger-Sequenzierung bestätigt.

Genotypisierung und Sequenzierung

  • F1: cggtttggagaagaaaaagc
  • R1: ccttcagagatcttgccaca
  • F2: tgccaatattcagaggcataa
  • R2: ccagttaccaagcttagcattt

Q623H: Extrahierte genomische DNA wurde durch PCR mit Primern amplifiziert ttaaatttggaagggacgttt und acttttattaggttgaggtg und dann mit BglII zur Genotypisierung verdaut. Unverdautes PCR-Produkt wurde einer Sequenzierung unter Verwendung eines der beiden Primer unterzogen. Um die Genauigkeit unserer Genotypisierung sicherzustellen und die Expansion einer Subpopulation auszuschließen, haben wir unsere Zellen am Ende der Telomerlängenexperimente genotypisiert. Darüber hinaus haben wir genotypisierende PCR-Amplikons in PCR2.1 subkloniert. Die Sequenzierung dieser Plasmide unterstützte alle unsere Genotypisierungsergebnisse.

WT/Y223C: Die anfängliche Insertion der Puromycin-Kassette wurde durch PCR nachgewiesen, wobei genomische DNA aus einzelnen Klonen extrahiert und durch PCR unter Verwendung von Primern amplifiziert wurde tgccaatattcagaggcataag und gcctttttcattctaaagcag, und amplifizierte Produkte wurden einer Sequenzierung unter Verwendung eines der beiden Primer unterzogen. Ein korrekt ausgerichteter Klon wurde identifiziert und zwei CAS9-Leitfaden-RNAs unterzogen, die auf die de novo NcoI-Stellen flankieren die Puromycin-Kassette und entfernen diese durch „narbenlose Schleife“. Nach dieser Targeting-Runde wurde die extrahierte genomische DNA durch PCR unter Verwendung von Primern amplifiziert gtccgtctgcgagggtacta und gccatatctaaactgtgcacct, wobei ein Verlust einer Bande die Entfernung der Puromycin-Kassette und ein erfolgreiches Targeting anzeigte.

In vitro Unterscheidung

hCD34 + -Zellen wurden unter Verwendung etablierter Differenzierungsprotokolle (Giarratana et al., 2005 DeWitt et al., 2016). Kurz gesagt wurden hCD34 + -Zellen in IMDM kultiviert, das mit 5 % Human-AB-Serum, Heparin (2 IU/ml), Humaninsulin (10 µg/ml), Human-Holotransferrin (330 µg/ml), rekombinantem Human-Erythropoietin (3 Einheit/ml), Hydrocortison (1 µM), rekombinanter humaner Stammzellfaktor (100 ng/ml) und humanes Interleukin-3 (5 ng/ml) für 7 Tage. Zur koloniebildenden klonalen Expansion wurden CD34 + -Zellen in Medium auf Methylcellulosebasis (MethoCult Express 04437, StemCell Technologies) ausgesät. Um Kolonien zu charakterisieren, die aus Einzelzellen hervorgegangen sind, wurden Zellen unter Verwendung begrenzter Verdünnung auf 96-Well-Platten ausplattiert. 2–3 Wochen nach der Aussaat wurden einzelne Kolonien gesammelt und durch Sanger-Sequenzierung oder NGS genotypisiert.

Xenotransplantation

NBSGW-Mäuse aus dem Jackson-Labor wurden für die in vivo Studien gemäß dem vom Office of Laboratory Animal Care (OLAC) in UC Berkeley genehmigten Protokoll. Elektroporierte hCD34 + -Zellen wurden 6 bis 12 Wochen alten Mäusen mit passendem Geschlecht über die Schwanzvene injiziert. Um den menschlichen Chimärismus zu überwachen, wurde Mäuseblut nach der Transplantation aus der Submandibularis in EDTA-beschichtete Sammelröhrchen gesammelt. Rote Blutkörperchen wurden unter Verwendung von EL-Puffer (QIAGEN) lysiert und zweimal mit phosphatgepufferter Kochsalzlösung (PBS) gewaschen. Empfängermäuse wurden in den Wochen 16–20 nach der Transplantation eingeschläfert. Knochenmarkzellen wurden aus Femur und Tibia gesammelt. Bei diesen Isolierungen beobachteten wir keine offensichtlichen Hinweise auf eine hämatopoetische Neoplasie. Zum Ex-vivo Kultur, hCD34 + -Zellen aus Knochenmark wurden unter Verwendung von FACS Aria Fusion (BD Biosciences) sortiert und unter Verwendung einer limitierten Verdünnungskulturmethode in Methylcellulose-basiertem Medium auf einer 96-Well-Platte für 3 Wochen kultiviert.

Genotypisierung und NGS-Analyse

  • POT1 NGSF: GCTCTTCCGATCTAAACTACTCTACTCTCTTATGGCA
  • POT1 NGSR: GCTCTTCCGATCTaaatttacatgagcaaaaatcact
  • AAVS1 NGSF: GCTCTTCCGATCTcccctatgtccacttcagga
  • AAVS1 NGSR: GCTCTTCCGATCTggaatctgcctaacaggaggt

Durchflusszytometrie und Sortierstrategie

100–200 µl homogenisierte Milz oder peripheres Blut wurden mit 2 ml EL-Puffer (QIAGEN) 1 min lang behandelt, um rote Blutkörperchen zu lysieren. Die Reaktion wurde durch Zugabe von 5–6 Volumen gekühltem PBS gequencht. Nach Zentrifugation und Entfernung des Überstands wurden die Zellen mit spezifischen Oberflächenmarker-Antikörpern gefärbt. Die folgenden Antikörper (BD Biosciences) wurden verwendet: V450 Maus anti-human CD19 (BD 560353), PE Ratte-anti-Maus CD45 (BD 553081), PE-Cy7 Maus anti-human CD34 (BD 348791) und FITC Maus anti -humanes CD45 (BD 555482). Die Zellen wurden unter Verwendung des FACS Aria Fusion-Instruments sortiert. Die FACS-Daten wurden mit der FlowJo-Software analysiert.

Einzeltelomerlängenanalyse (STELA)

  • Telorette 3: TGCTCCGTGCATCTGGCATCCCTAACC
  • Teltail: TGCTCCGTGCATCTGGCATC
  • XpYpE2: GTTGTCTCAGGGTCCTAGTG
  • XpYpB2: TCTGAAAGTGGACCTATCAG

Telomer-Restriktionsfragment-Analyse (TRF-Analyse)

Die TRF-Analyse wurde wie zuvor beschrieben durchgeführt (Boyle et al., 2020). Kurz gesagt wurde genomische DNA mit MboI, AluI und RNaseA über Nacht bei 37 °C verdaut und auf einem 0,75% Agarosegel aufgetrennt, unter Vakuum 2 h bei 50 °C getrocknet, in 0,5 M NaOH und 1,5 M NaCl 30 min denaturiert , Schütteln bei 25 °C und neutralisieren mit 1 M Tris pH 6,0 und 2,5 M NaCl, Schütteln bei 25 °C, 2 × 15 min. Anschließend wurde das Gel in Church-Puffer (1% BSA, 1 mM EDTA, 0,5 M NaPO .) vorhybridisiert4 pH 7,2, 7% SDS) für 1 h bei 55°C, bevor ein 32 P-endmarkiertes (C3TG2)3 Telomersonde. Das Gel wurde 3 × 30 min in 4 × SSC bei 50 °C und 1 × 30 min in 4 × SSC + 0,1% SDS bei 25 °C gewaschen, bevor es auf einem Phosphor-Imager-Bildschirm belichtet wurde.

T7-Endonuklease-I-Assay

Der genomische Locus, auf den sgRNA abzielte, wurde durch PCR amplifiziert. Die PCR-Produkte wurden in einem Volumen von 20 ul hergestellt, das NEB-Puffer 2 (New English Biolabs, Inc.) enthielt. Vor der T7-Endonuklease-Behandlung wurde das gereinigte PCR-Produkt bei 95 °C für 5 Minuten denaturiert und durch langsames Abkühlen auf Raumtemperatur wieder angelagert. Nach 30-minütiger Behandlung mit 5 Einheiten T7-Endonuklease I bei 37ºC wurde das Endprodukt durch Elektrophorese aufgetrennt und sichtbar gemacht.

IF/TIF-Analyse

Die Analyse wurde wie zuvor in Boyle . beschrieben durchgeführt et al (2020). Zur Analyse durch IF wurden die Zellen mit PBS gewaschen, mit 2 % Paraformaldehyd in PBS fixiert, mit 0,1 % Triton X-100 permeabilisiert und mit 1 mg/ml BSA, 3 % v/v Pferdeserum und 1 mM EDTA in . blockiert PBS. Nach der Blockierung wurden die Zellen mit Antikörpern gegen TRF1, die in Kaninchen gegen die Aminosäurereste 17-41 (856-R1) und γ-H2AX (Millipore) in Blockierungslösung erzeugt wurden, inkubiert, gefolgt von sekundären Antikörpern. Die Bewertung von TIF-positiven Zellen wurde einfachblind durchgeführt. Für jede Bedingung wurden mehr als 50 Zellen ausgewertet. P-Werte wurden mit dem Mann-Whitney-Test von Prism 9 bestimmt. Als Positivkontrolle und um zu zeigen, dass diese Zellen für TIFs kompetent sind, infizierten wir sie mit einem TPP1∆PBD exprimierenden Lentivirus oder einem leeren Kontrollvirus und färbten sie 72 Stunden nach der Infektion auf TIFs. Zellen, die nicht mit dem Virus infiziert waren, blieben TIF-negativ.

Metaphase Spreads/FISH

Die Analyse wurde wie zuvor in Boyle . beschrieben durchgeführt et al., (2020). Die Zellen wurden 2 h mit 100 ng/ml Colcemid behandelt. Wir sammelten die Zellen unter Verwendung von Trypsin und inkubierten bei 37 °C in vorgewärmtem 75 mM KCl. Die Zellen wurden abzentrifugiert und das KCl wurde entfernt. Die Zellen wurden langsam in einem Fixiermittel von 3:1 Methanol:Essigsäure resuspendiert. Die Zellen wurden über Nacht bei 4°C gelagert. Am nächsten Tag wurden die Zellen tropfenweise auf Mikroskop-Objektträger ausgestrichen und zweimal mit 1 ml 3:1 Methanol:Essigsäure-Lösung gewaschen. Die Objektträger wurden dann für 5 Minuten auf einen befeuchteten 80 °C-Heizblock gelegt. Die Proben wurden in 3,7% Formaldehyd, verdünnt in PBS, fixiert und dann mit Pepsin (1 mg/ml), hergestellt in 10 mM Glycin pH 2, behandelt und auf 37 Grad erwärmt. Nach einem weiteren Waschgang in 4% PFA wurden die Objektträger mit PBS gewaschen und dann in einer Ethanolreihe entwässert. Jeder Objektträger erhielt 100 ul Hybridisierungsmischung, wurde 5 min bei 80 Grad denaturiert und dann über Nacht mit Cy3 Tel-C-Sonden (PNA Bio) bei 4 Grad in einer Hybridisierungskammer hybridisiert. Am nächsten Tag wurden die Objektträger mit 70 % Formamid, 10 mM Tris-HCl pH 7,2 und 0,1 % BSA-Lösung gewaschen, dann mit 0,1 M Tris-HCl pH 2, 0,15 M NaCl und 0,08 % Tween und mit DAPI ( verdünnt 1:1.000 aus 5 mg/ml Vorrat) zur zweiten Waschung zugegeben. Deckgläser wurden mit ProLong® Gold Antifade Mountant (Thermo Fisher Scientific) befestigt. Die gesamte Mikroskopie (IF- und Metaphase-Spreads) wurde auf einem Nikon Eclipse TE2000-E Epifluoreszenzmikroskop, ausgestattet mit einer Andor Zyla sCMOS-Kamera, abgebildet.


Die Länge der Telomere beeinflusst die Differenzierung von Krebszellen

Forscher der japanischen Stiftung für Krebsforschung in Tokio haben herausgefunden, dass die forcierte Verlängerung von Telomeren (Verlängerungen am Ende der Chromosomen) die Differenzierung von Krebszellen fördert und wahrscheinlich die Malignität reduziert, die stark mit einem Verlust der Zelldifferenzierung verbunden ist. Sie berichten über ihre Ergebnisse in einem Manuskript, das vor der Drucklegung online in der Zeitschrift veröffentlicht wurde Molekular- und Zellbiologie.

"Krebszellen können kurze Telomere aufrechterhalten, um ihren undifferenzierten Zustand aufrechtzuerhalten", sagt Hiroyuki Seimiya, ein Forscher der Studie.

Telomere sind schützende Verlängerungen an den Enden der Chromosomen, die sich mit zunehmendem Alter der Zellen verkürzen, wie eine Sanduhr, die herunterläuft. Sie schützen das Ende des Chromosoms vor Zerstörung oder vor Verschmelzung mit benachbarten Chromosomen. Ohne Telomere würden die Chromosomen nach und nach genetische Informationen verlieren, wenn sich Zellen teilen und replizieren.

Krebszellen haben im Vergleich zu gesunden Zellen kürzere Telomere, aber sie schützen ihre Unsterblichkeit, indem sie die Länge dieser Telomere beibehalten.

In der Studie unterdrückte die erzwungene Verlängerung der Telomere von Krebszellen laut dem Bericht eine Reihe von Genen und Proteinen, die an der Malignität von Tumoren beteiligt zu sein scheinen. Einer dieser Faktoren, N-Cadherin, ist beispielsweise an der Metastasierung von Prostatakrebs beteiligt.

Basierend auf ihren Ergebnissen schlagen die Forscher nun vor, dass Telomere auch das Verhalten von Zellen modulieren, indem sie die Genexpression durch noch unbekannte Mechanismen kontrollieren, sagt Seimiya. Seine Forschung, sagt er, könnte letztendlich zu neuen Behandlungsmethoden für Krebs führen.